ID: 1073029299

View in Genome Browser
Species Human (GRCh38)
Location 10:100512268-100512290
Sequence CTCAGTGTATAGAGAGGGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073029296_1073029299 -8 Left 1073029296 10:100512253-100512275 CCAGAGAGCTAGAAACTCAGTGT 0: 1
1: 0
2: 2
3: 10
4: 149
Right 1073029299 10:100512268-100512290 CTCAGTGTATAGAGAGGGTAAGG No data
1073029294_1073029299 13 Left 1073029294 10:100512232-100512254 CCAGAGGTTATGGGGGCCACTCC 0: 1
1: 0
2: 0
3: 12
4: 96
Right 1073029299 10:100512268-100512290 CTCAGTGTATAGAGAGGGTAAGG No data
1073029295_1073029299 -3 Left 1073029295 10:100512248-100512270 CCACTCCAGAGAGCTAGAAACTC 0: 1
1: 0
2: 0
3: 11
4: 144
Right 1073029299 10:100512268-100512290 CTCAGTGTATAGAGAGGGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073029299 Original CRISPR CTCAGTGTATAGAGAGGGTA AGG Intronic
No off target data available for this crispr