ID: 1073034423

View in Genome Browser
Species Human (GRCh38)
Location 10:100553284-100553306
Sequence CTTAGGGATCAGTAGTTCAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 97}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073034415_1073034423 16 Left 1073034415 10:100553245-100553267 CCCTTCATGGAGGGTTTCCATCT 0: 1
1: 0
2: 0
3: 11
4: 159
Right 1073034423 10:100553284-100553306 CTTAGGGATCAGTAGTTCAGGGG 0: 1
1: 0
2: 0
3: 4
4: 97
1073034414_1073034423 17 Left 1073034414 10:100553244-100553266 CCCCTTCATGGAGGGTTTCCATC 0: 1
1: 0
2: 0
3: 7
4: 130
Right 1073034423 10:100553284-100553306 CTTAGGGATCAGTAGTTCAGGGG 0: 1
1: 0
2: 0
3: 4
4: 97
1073034417_1073034423 -1 Left 1073034417 10:100553262-100553284 CCATCTAAATGCATCTGTGTGCC 0: 1
1: 1
2: 2
3: 17
4: 188
Right 1073034423 10:100553284-100553306 CTTAGGGATCAGTAGTTCAGGGG 0: 1
1: 0
2: 0
3: 4
4: 97
1073034416_1073034423 15 Left 1073034416 10:100553246-100553268 CCTTCATGGAGGGTTTCCATCTA 0: 1
1: 0
2: 1
3: 5
4: 108
Right 1073034423 10:100553284-100553306 CTTAGGGATCAGTAGTTCAGGGG 0: 1
1: 0
2: 0
3: 4
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073034423 Original CRISPR CTTAGGGATCAGTAGTTCAG GGG Exonic
901863612 1:12089966-12089988 GTTAGGGAACAGTAGGTGAGTGG - Intronic
902419482 1:16267332-16267354 CTTAGGAAGCAGGAGTTTAGAGG - Intronic
902571293 1:17348459-17348481 TTTTGGGATCAGTGGATCAGTGG + Intronic
903340428 1:22651021-22651043 CTTGGGGATCAGGAGCTGAGGGG - Intergenic
906106043 1:43293226-43293248 CTTAGGGATAACTGGCTCAGAGG - Intergenic
912357410 1:109066453-109066475 CTTAGGGTTCAGTAGGTGGGAGG - Intronic
914956905 1:152171015-152171037 CTGAGGGAACAGTATTTCTGTGG - Intergenic
919450270 1:197763749-197763771 CTTAGGGAACAGTAGAGGAGTGG - Intronic
919972627 1:202590926-202590948 CTTAGCGATCAGGACTTTAGGGG - Exonic
921712723 1:218388643-218388665 CTCAGGGATCAGCTATTCAGCGG - Intronic
923234295 1:232017696-232017718 GCTAGGGATCAGTGGTGCAGGGG - Intronic
1063684106 10:8220057-8220079 CTTAGGGAACAGTAATTAACTGG - Intergenic
1065097302 10:22294297-22294319 CTTAGGAAATAGAAGTTCAGAGG + Intergenic
1066443185 10:35458218-35458240 CTTAGGGATCAGCAACTCTGAGG - Intronic
1071995492 10:91144064-91144086 CCTGTGGATCAGGAGTTCAGGGG - Intergenic
1073034423 10:100553284-100553306 CTTAGGGATCAGTAGTTCAGGGG + Exonic
1074195082 10:111176735-111176757 GTTACAGATCAGGAGTTCAGGGG + Intergenic
1077021432 11:418836-418858 GTCAGGGGTCAGGAGTTCAGAGG + Intronic
1083703615 11:64497915-64497937 CTTAGGAATTAGGAATTCAGTGG - Intergenic
1084547300 11:69820790-69820812 CTGAGGCTCCAGTAGTTCAGTGG - Intergenic
1087121750 11:94582192-94582214 CTTTGGGATGAGTGGTTGAGGGG - Intronic
1087956511 11:104294855-104294877 TTTAGGGATCAGTAGTTACCTGG - Intergenic
1088655085 11:111991405-111991427 CCTTGGCATCAGTAGTTCAAAGG - Intronic
1089025515 11:115265660-115265682 ATTTGGGACCAGTAGTTCACTGG + Intronic
1092009855 12:5100296-5100318 CTGAGGGATAAGCAGATCAGAGG - Intergenic
1095508099 12:42920018-42920040 ATGAGGGAACAGTAGGTCAGAGG + Intergenic
1097808864 12:63995984-63996006 CTTAGAGATCTGTAGTCAAGTGG - Intronic
1097956664 12:65493908-65493930 CTTAGGGAACAAGAGTTCTGAGG + Intergenic
1100765518 12:97861442-97861464 CTTGGGGATTAGTATTTGAGGGG - Intergenic
1100867241 12:98869996-98870018 CTTGGGGTGCAGTAGTTAAGAGG + Intronic
1106314298 13:28579530-28579552 CTTAGGGAGCACAAGTTCAAAGG + Intergenic
1106927869 13:34632036-34632058 CTCAGGGATCAGTAACTCAAGGG + Intergenic
1107631704 13:42349744-42349766 CTTAGGAATCATCAGTACAGAGG - Intergenic
1109136000 13:58651843-58651865 CTTTGAGATCTGTGGTTCAGCGG + Intergenic
1110663007 13:78080413-78080435 CCCAGGCTTCAGTAGTTCAGTGG + Intergenic
1112690283 13:101885577-101885599 CCTAGGGATAAGGAATTCAGTGG - Intronic
1114490477 14:23097950-23097972 CTTTGGGATCAGTGGTTTCGAGG + Exonic
1115529663 14:34315600-34315622 CTAAGTGATCAAGAGTTCAGAGG - Intronic
1115909042 14:38235164-38235186 CTTAGGCATCAGAAGTTCTGGGG + Intergenic
1117442520 14:55773426-55773448 GTTAGGATTCAGTAGATCAGAGG + Intergenic
1118138139 14:63050222-63050244 CTTTGGGAACAGGAGATCAGAGG + Intronic
1122854690 14:104554442-104554464 CTTAGGGAACAGCAGGACAGAGG - Intronic
1124995258 15:34717374-34717396 CTTAGGGGTCAGTTGTAGAGGGG - Intergenic
1129482472 15:75838853-75838875 TTTAGGGATTAGAAGGTCAGTGG - Intergenic
1130544194 15:84842707-84842729 CTGTAGGAACAGTAGTTCAGAGG + Intronic
1144197617 17:12910401-12910423 CTCAGGGATGAGTAGATCAAAGG + Intronic
1144754729 17:17672290-17672312 CTAAGGGATATGTACTTCAGAGG - Intergenic
1151670014 17:75566872-75566894 CTTATGGGTCTGGAGTTCAGAGG + Intronic
1158819231 18:61139692-61139714 CTTAAAATTCAGTAGTTCAGAGG - Intergenic
1159748914 18:72276312-72276334 CTGTGGGATCAGTGGATCAGTGG - Intergenic
1162156699 19:8683423-8683445 GTCAGGCATCAGTGGTTCAGTGG - Intergenic
926129515 2:10292992-10293014 CTTAGGCATCTGTAGTCCAGGGG + Intergenic
928783872 2:34857812-34857834 CTGAATGATCAGTAGGTCAGTGG + Intergenic
932793023 2:74672329-74672351 CTGAGGGAACAGTATCTCAGAGG - Intronic
942325663 2:174775046-174775068 TTTAGTGTTCTGTAGTTCAGTGG + Intergenic
945860258 2:215113156-215113178 TTTAAGGATCAGTAATTCATGGG - Intronic
948435126 2:237948036-237948058 CTTAGTGATGAGTAACTCAGAGG - Intergenic
1175841725 20:62032260-62032282 CTCAGGGAGCAGGAGTTCGGGGG - Intronic
1179165190 21:38930047-38930069 CTCAGGGATGAGTAACTCAGAGG + Intergenic
1182440271 22:30359278-30359300 CTTGGGCAGCAGTAGTTCATTGG + Intronic
1183674639 22:39292495-39292517 CTTAGGGAAGAGTAATTCACTGG - Intergenic
949382688 3:3463838-3463860 CTTAGACATCAGAAGTCCAGGGG + Intergenic
951630611 3:24716267-24716289 CCCAGGGATCACCAGTTCAGGGG + Intergenic
951954996 3:28243716-28243738 CCTAGGGAACAGTAGTACATAGG + Intronic
963981747 3:151545888-151545910 GTTAGGAATCTGTAGTGCAGGGG + Intergenic
966420658 3:179731458-179731480 CTGAGGAATCAGAATTTCAGGGG + Intronic
968331741 3:197876713-197876735 ATTAGGTATCAGTAACTCAGGGG + Intronic
969762032 4:9193437-9193459 CTTTGGGATCACGAGGTCAGTGG + Intergenic
971559518 4:28058921-28058943 CTTGTGCAACAGTAGTTCAGAGG - Intergenic
976071469 4:81244880-81244902 CATAGTGATCACAAGTTCAGAGG - Intergenic
978775539 4:112502856-112502878 CTAAGGGAACACTAGTTCATAGG + Intergenic
978932585 4:114333792-114333814 CTTAAGTATCAGTATTTCATAGG - Intergenic
985517253 5:353398-353420 CTCAGGGATCCGTAGTGGAGAGG + Intronic
985695307 5:1336831-1336853 CTGAGGGAACAGCAGTACAGGGG + Intronic
990172065 5:53062539-53062561 CTCAGGGATCTGTATTTCAAAGG + Intronic
990803079 5:59627791-59627813 CTTAGGGATAAGCAGTGCTGGGG - Intronic
991412959 5:66362999-66363021 AATAGAGATCAGTTGTTCAGTGG - Intergenic
994857862 5:105148156-105148178 CTTCGGGAGAAGTAGGTCAGTGG + Intergenic
1004551675 6:16654001-16654023 CTTATGAATCAGAAGTTCTGGGG - Intronic
1006388581 6:33746003-33746025 CTATGGGATCAGAATTTCAGGGG + Intronic
1007470103 6:42084254-42084276 CATAGGGGTCAGAAGTGCAGAGG + Intronic
1007683084 6:43647821-43647843 TTTAGGCACCAGGAGTTCAGTGG + Intronic
1008714507 6:54272668-54272690 CTGAGGGATCAGTCCCTCAGGGG - Intergenic
1008939333 6:57029528-57029550 CTTTGCGCTTAGTAGTTCAGAGG + Intergenic
1018280856 6:162183922-162183944 CTTAGATAGCACTAGTTCAGGGG - Intronic
1022241586 7:28517566-28517588 CATAGGTACCAGTAATTCAGGGG - Intronic
1023206962 7:37761617-37761639 CTTAGGGTTTATTAGGTCAGAGG + Intronic
1031687038 7:124743556-124743578 CTGAGGGATCAGTGGTTGAGAGG - Intergenic
1033422274 7:141214384-141214406 TTTAGGGAGCTCTAGTTCAGGGG + Intronic
1036752638 8:11453021-11453043 CTGAGGGGTCAGGAGTGCAGGGG - Intronic
1036844506 8:12155578-12155600 CTTTGGGATCACGAGGTCAGTGG - Intergenic
1036865876 8:12397912-12397934 CTTTGGGATCACGAGGTCAGTGG - Intergenic
1037740452 8:21604825-21604847 CACTGTGATCAGTAGTTCAGTGG + Intergenic
1041268280 8:56085793-56085815 CTTTGGGCTTAGTAGTTAAGGGG - Intergenic
1045608673 8:103809288-103809310 CTTGGAGTTCAGAAGTTCAGAGG - Intronic
1047850812 8:128855345-128855367 CTTGGGGAAAAGTAGTTGAGGGG + Intergenic
1048810399 8:138280587-138280609 CTTAGAGTTCAGTAGTGCTGTGG + Intronic
1049993991 9:1017485-1017507 CCCAGGGATCAGCAGTCCAGGGG - Intergenic
1054805740 9:69394477-69394499 CTTAGGAATCCATAGTCCAGTGG + Intergenic
1059229752 9:112708633-112708655 CTTATGGATCTATAGGTCAGAGG + Intronic
1060122335 9:121005055-121005077 CTTAGAGATTAGAATTTCAGTGG - Intronic
1187305770 X:18093960-18093982 CTTGAGGATCAGGAGTTCAGTGG - Intergenic