ID: 1073034701

View in Genome Browser
Species Human (GRCh38)
Location 10:100555464-100555486
Sequence AGATTAATGGGATCATGATG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 154}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073034701 Original CRISPR AGATTAATGGGATCATGATG TGG (reversed) Exonic
904512196 1:31020845-31020867 TGATTAATTGGTGCATGATGTGG - Intronic
907597102 1:55730288-55730310 AGAATAATTGGATCCTGAGGTGG + Intergenic
909244208 1:73256488-73256510 AGATTAATGTGTTAATGATTTGG - Intergenic
910660356 1:89665021-89665043 AGCTTAAGGAGATGATGATGGGG + Intronic
910679224 1:89844862-89844884 AGTTTGATGGGATCATTATATGG + Intronic
911198763 1:95022647-95022669 AGATTAATGAAATCATAATTGGG - Intronic
911545850 1:99215558-99215580 AGAGTAATGGGATAATAATATGG + Intergenic
914831140 1:151171789-151171811 AGATTATGGGGAACATGTTGGGG - Intronic
916447516 1:164887318-164887340 AAATTAATGGGGATATGATGAGG - Intronic
918599483 1:186338995-186339017 ATATAAATGGGACCATGATATGG + Intronic
1063424140 10:5938256-5938278 GGAGTACTGGGATCATGATAGGG + Intronic
1063456987 10:6190726-6190748 AAGTTAATGGGAAGATGATGTGG - Intronic
1063794123 10:9491543-9491565 AGAGTAATGAGAACATGGTGGGG + Intergenic
1064709523 10:18109376-18109398 AGATGAATGGGTGAATGATGTGG + Intergenic
1064887396 10:20125102-20125124 ACATTACTGGGATCAAGCTGGGG - Intronic
1065009766 10:21410698-21410720 AGATGAATGGCAAAATGATGCGG - Intergenic
1066697435 10:38091563-38091585 AGATTAGTTGGATCATCAGGTGG + Intergenic
1066995104 10:42555906-42555928 AGATTAGTTGGATCATCAGGTGG - Intergenic
1068028118 10:51674262-51674284 AGGTTGATGGGTGCATGATGGGG - Intronic
1069159120 10:65070605-65070627 AGATAAATGTGAACATAATGAGG - Intergenic
1070550120 10:77484389-77484411 CCATTAATTGGATTATGATGGGG - Intronic
1070934954 10:80286211-80286233 GAATTAAAGGGAACATGATGAGG - Intronic
1072615240 10:97044892-97044914 AGTGTGATGGGATCAGGATGGGG + Intronic
1072841372 10:98777885-98777907 AAATTAAGGGAAACATGATGTGG + Intronic
1073034701 10:100555464-100555486 AGATTAATGGGATCATGATGTGG - Exonic
1075680796 10:124329902-124329924 AGAAGAATGGGATGATGGTGGGG - Intergenic
1076358660 10:129870847-129870869 TGATTAATGGGACCAGGCTGGGG - Intronic
1077723389 11:4649477-4649499 AGATCATAGGGATCATGGTGAGG + Intronic
1077803122 11:5561824-5561846 AGATAATTGGGTTCATCATGGGG - Intronic
1079981214 11:27153442-27153464 AGATTCAGGGGATAAGGATGTGG - Intergenic
1081694013 11:45097033-45097055 AGGTAAATGGGATGAAGATGAGG + Intronic
1081970071 11:47192211-47192233 AGAATAATGAGGTCATGATGGGG + Intergenic
1084323117 11:68384540-68384562 AGGTTGCTGGGATCAGGATGTGG - Intronic
1087333503 11:96813614-96813636 AAATTAATGGTAGCTTGATGGGG - Intergenic
1087569419 11:99905678-99905700 AAGTTAATGGTATCTTGATGGGG + Intronic
1088860831 11:113797933-113797955 AGATTAATGGAATCATGAAAGGG - Exonic
1088908073 11:114169810-114169832 AGGTTCATGGGATTTTGATGAGG + Intronic
1089924340 11:122241911-122241933 AGGTTAATGGGGCTATGATGGGG - Intergenic
1090132492 11:124159254-124159276 AGATTAAGGGGTTCAGCATGGGG - Intergenic
1090436235 11:126688891-126688913 AGAGGAATGGGAAGATGATGAGG + Intronic
1090520611 11:127475122-127475144 ACATTAAAGGGAAAATGATGAGG - Intergenic
1091636751 12:2203029-2203051 ACTTTAATAGGATCCTGATGGGG - Intronic
1092000155 12:5025019-5025041 AGATTCTTGGGATCATGGGGTGG + Intergenic
1092969696 12:13680976-13680998 AGCTTAATGGGATCAGGCTAAGG + Intronic
1099946745 12:89253886-89253908 AGATTGATGGGTTGATGCTGGGG - Intergenic
1100661501 12:96703946-96703968 TGAATGATGGGATAATGATGGGG + Intronic
1102727807 12:115080936-115080958 AGATTATTGGGAGGATTATGTGG + Intergenic
1103285713 12:119799631-119799653 AGGGTAATGGGATCTTGATGGGG - Intronic
1105674215 13:22652894-22652916 AGATTAATGGCACCATTATCAGG - Intergenic
1105730481 13:23210748-23210770 AAACTCATGGGATCATTATGAGG - Intronic
1105815683 13:24034149-24034171 AGACTCCTGGGATGATGATGGGG + Intronic
1107063532 13:36187600-36187622 AGATTAGTGGGAAGATGATGGGG - Intronic
1107900677 13:45010646-45010668 ATATAAATGGAACCATGATGGGG + Intronic
1109369207 13:61399354-61399376 ACATTTATGTGATGATGATGGGG + Intergenic
1110038283 13:70717195-70717217 AGATTATTTGAATCATGCTGTGG + Intergenic
1115290298 14:31764080-31764102 AAAATAATTGGATCATGATAGGG - Intronic
1117040294 14:51763153-51763175 AGATGAAGGGGTTCATCATGGGG + Intergenic
1118858548 14:69643544-69643566 GGTTTAATGGGACCATGATCAGG - Intronic
1119929986 14:78536350-78536372 AGATTATTAGGAACGTGATGCGG - Intronic
1120306685 14:82779898-82779920 AGATTTAGGGGATCATCATGGGG - Intergenic
1122431150 14:101646239-101646261 ACATTAATGGGATTTTGATCAGG - Intergenic
1124390690 15:29254109-29254131 AGATTAATCTGATCAAGAGGCGG + Intronic
1127688143 15:61368575-61368597 GGATTCATGGGACCTTGATGAGG + Intergenic
1129630426 15:77253368-77253390 AGTTGAATGGTATCATTATGAGG - Intronic
1130699975 15:86168210-86168232 AGATTAATGTGATCATGGGGGGG + Intronic
1130837985 15:87670603-87670625 AAATTAATGGGTTCATAATCTGG + Intergenic
1131059003 15:89392956-89392978 TGATAAATGGACTCATGATGGGG - Intergenic
1134365406 16:13572564-13572586 AAATTAATGGGATCATGGTGGGG - Intergenic
1134482374 16:14630645-14630667 AGAATAATGGGATCCGGGTGCGG + Intronic
1139166865 16:64576643-64576665 ATATTAAAGGGATGGTGATGAGG + Intergenic
1141647951 16:85377552-85377574 AGTTAAATGAGATGATGATGAGG + Intergenic
1142151356 16:88513921-88513943 AGATCAATGGGATTATCAGGTGG - Intronic
1143827739 17:9626080-9626102 CAATTGATTGGATCATGATGAGG - Intronic
1150050078 17:61953333-61953355 AGATTCCTGGGATTAGGATGTGG - Intronic
1150901756 17:69286403-69286425 TGATTAATGATATCATAATGTGG - Intronic
1157881360 18:51324026-51324048 AGTTTAATGAGATGATAATGGGG - Intergenic
1159554203 18:69928351-69928373 ACATTATTGGGATCATGAAGAGG + Intronic
1160705237 19:526439-526461 AGATTCTGGGGATCAGGATGTGG + Intergenic
1161881304 19:6955221-6955243 TGATTAAAATGATCATGATGAGG + Intergenic
1165764964 19:38344484-38344506 AGATTAATGGGATCTTCATGTGG - Intronic
928706399 2:33954258-33954280 AGATAAATGGGACCAGGAAGTGG - Intergenic
933296265 2:80494597-80494619 ATATTTATTGGGTCATGATGTGG + Intronic
934157364 2:89216042-89216064 TGGTTAATGTCATCATGATGGGG - Intergenic
934209955 2:89966701-89966723 TGGTTAATGTCATCATGATGGGG + Intergenic
935072346 2:99705920-99705942 AAATTAATGTGATCCTGTTGGGG + Intronic
938708581 2:133955632-133955654 AGATTAATGGCAAGATGAAGAGG - Intergenic
939457836 2:142461413-142461435 AATTAAATGGGAACATGATGGGG + Intergenic
940214205 2:151288146-151288168 AGATTCTTGGGATTAAGATGTGG - Intronic
941759797 2:169229269-169229291 ACATTAATGGGATTATGACATGG - Intronic
942117609 2:172743543-172743565 ATATTAATGGGATATTCATGTGG - Intronic
942832832 2:180257122-180257144 AGATAAATGGGAAGACGATGGGG + Intergenic
1170025478 20:11884683-11884705 AGATTAGTGGTAACTTGATGGGG + Intergenic
1170583763 20:17718619-17718641 AGATAAATGGGGTGAGGATGGGG - Intronic
1173339736 20:42142463-42142485 AGAATAAAGGGATAGTGATGAGG + Intronic
1174240707 20:49132330-49132352 AGATTGGGGGGATCTTGATGTGG - Intronic
1174901743 20:54507871-54507893 AGTTTAAAGAGTTCATGATGAGG + Intronic
1175492643 20:59389599-59389621 AGATTCTAGGGATTATGATGTGG + Intergenic
1183054520 22:35295515-35295537 ACATTAATGAAATCCTGATGAGG + Exonic
950109692 3:10411032-10411054 AGGTTCCGGGGATCATGATGTGG - Intronic
950720611 3:14879927-14879949 AGATTGGTGGGGTCATGAAGTGG + Intronic
952609017 3:35184397-35184419 AGATTATTGGGATGATGGTGTGG + Intergenic
953218662 3:40946828-40946850 AGATCATTGGGAGCCTGATGGGG + Intergenic
955830085 3:62992171-62992193 AGATTAATTGGATCAAGTAGAGG - Intergenic
956344650 3:68265127-68265149 AGTTTAACAGAATCATGATGAGG - Intronic
957887290 3:86303719-86303741 AGATTAAGATGATCACGATGTGG + Intergenic
957944582 3:87046943-87046965 AGATGAATGGCATGGTGATGTGG + Intergenic
958737116 3:98022311-98022333 AGATTAATTGACTCATTATGTGG - Intronic
959327702 3:104957502-104957524 AGTTTAATGGGCTCAGAATGGGG + Intergenic
959880795 3:111442681-111442703 AGGTCAATGGTATCTTGATGGGG + Intronic
962966458 3:140358748-140358770 AGACTAATGGGATCAAAATAAGG - Intronic
964568844 3:158090208-158090230 AGGTTACAGGGATCAGGATGTGG + Intergenic
964586395 3:158309304-158309326 ATATTTAAGGGATCTTGATGTGG + Intronic
969287747 4:6216018-6216040 AGATGAATGAGAATATGATGTGG + Intergenic
970465304 4:16316401-16316423 AGAAGAAAGGGATGATGATGAGG - Intergenic
970708512 4:18834095-18834117 GGCCTAATGGGATCATGATGTGG - Intergenic
974220618 4:58965424-58965446 AGATTAGTGTGTTCTTGATGGGG + Intergenic
975681064 4:76876612-76876634 AGTTGAATGTGATCAGGATGGGG - Intergenic
977363736 4:96039763-96039785 AAATTAATTTGATCATGAAGTGG - Intergenic
977619484 4:99120266-99120288 AGATGAATGGCAGAATGATGTGG + Intergenic
981983039 4:150819307-150819329 AGACCAATGATATCATGATGGGG + Intronic
983269520 4:165544799-165544821 AGAGTAATGTGATCATCATTAGG + Intergenic
983271082 4:165562489-165562511 AGTTTAATTGGGTCATTATGAGG + Intergenic
986959593 5:13197381-13197403 AGAATAATTGGATCCTGAGGTGG + Intergenic
987271558 5:16314608-16314630 AGATTAATGGCATAATGGTGTGG + Intergenic
987420100 5:17709822-17709844 ATTTTAAGGGGATTATGATGAGG + Intergenic
988913730 5:35871604-35871626 AGATTCATGGGACCAGCATGAGG + Intronic
991536616 5:67675696-67675718 AGATCGTTGGAATCATGATGTGG - Intergenic
994076880 5:95662200-95662222 AGATTAATTGGATACTCATGGGG + Intronic
994858822 5:105161553-105161575 AAGTTAATGGGAGCTTGATGGGG - Intergenic
994958225 5:106562509-106562531 AGAATAATTGGATCCTGAGGTGG + Intergenic
995327768 5:110911057-110911079 TTTTTAATGGGATAATGATGAGG - Intergenic
995427140 5:112037968-112037990 AGATCAATGGTAGCTTGATGGGG - Intergenic
996188990 5:120515242-120515264 AGATTAATGTGATTATCATGGGG - Intronic
997214556 5:132100029-132100051 AGATAAAGGGGAAGATGATGCGG - Intergenic
1000001809 5:157145756-157145778 AGATTAATGTGATAGTGACGTGG + Intronic
1000822263 5:165999234-165999256 AGAATAATTGAATCATGAGGTGG + Intergenic
1001445346 5:171778400-171778422 GGATTCATAGGATCATGCTGGGG - Intergenic
1004868754 6:19881529-19881551 AGCTTAATGTGATCCTGAAGTGG + Intergenic
1005083015 6:21976228-21976250 AGATTAATGGGATTATGAGTTGG + Intergenic
1009787220 6:68355312-68355334 AGAATAATCGGATCCTGAGGTGG - Intergenic
1009810728 6:68661846-68661868 GCCTTAATGGGACCATGATGAGG + Intronic
1012188471 6:96251477-96251499 AGATGCATGGGATTTTGATGAGG - Intergenic
1013135708 6:107280949-107280971 AGCTGAAGGGGATCATGAGGAGG - Intronic
1013392310 6:109698472-109698494 AAATAAATGGCATCAAGATGGGG - Intronic
1015467171 6:133560054-133560076 GGAATAATTGGATCATGAGGTGG - Intergenic
1016165800 6:140941578-140941600 AGATTCAAGGGATCATGGTGAGG - Intergenic
1017169929 6:151447416-151447438 AGTGAAATGGGATCATTATGAGG - Intronic
1017561164 6:155629474-155629496 AGATTAATGTCATTATTATGGGG - Intergenic
1020673910 7:11156407-11156429 AGATTAATGGGTTCACTCTGGGG + Intronic
1020710090 7:11595792-11595814 AGAATAATTGGATCCTGAGGTGG + Intronic
1022278904 7:28885387-28885409 AGATTCATGGGATAATGAATGGG + Intergenic
1022764832 7:33400295-33400317 CTATTAATGGGCTCATTATGTGG + Intronic
1022892057 7:34711451-34711473 AGATTAATGGGCTCATTAGAAGG + Intronic
1026564321 7:71477270-71477292 AGAATAATGGGATTATGAGTGGG + Intronic
1030752893 7:113253110-113253132 ACATTAATGGTATTTTGATGGGG - Intergenic
1030753854 7:113265408-113265430 ATATTAATGGTATTTTGATGGGG - Intergenic
1039415459 8:37390139-37390161 ACATTAACGGGAGCATGATGGGG - Intergenic
1041841360 8:62275475-62275497 AGCTTAATAGGCTCATAATGTGG - Intronic
1042650341 8:71033598-71033620 AGATTAATGTCATCCTGAGGTGG + Intergenic
1042710174 8:71708499-71708521 AGATTAAGGGTATGGTGATGTGG - Intergenic
1046569337 8:115943149-115943171 AGATTTATGGGATATTCATGAGG + Intergenic
1046731310 8:117729327-117729349 AGATTCATGTGATCATGATTTGG - Intergenic
1051555569 9:18378849-18378871 AGGTTAATGGGATCAAGACAGGG + Intergenic
1053517094 9:38739827-38739849 TGATGAATGGGATAATGAGGAGG + Intergenic
1055344271 9:75317949-75317971 AGCTTAATTGGATCATAGTGTGG - Intergenic
1056464697 9:86842279-86842301 TGCTTAATGTGATGATGATGAGG + Intergenic
1058490799 9:105496431-105496453 AGCTTACTGGGATTATGATTGGG + Intronic
1059765724 9:117382079-117382101 AGAATAATGGGATGCTGATGGGG + Intronic
1061533130 9:131230239-131230261 AAATAAATGGGAGCAGGATGTGG + Intronic
1188496185 X:30785307-30785329 ATTTTAATGAGATCTTGATGGGG + Intergenic
1190063027 X:47222976-47222998 AGATGAATGGGATGATGCAGTGG + Intronic
1193453320 X:81698482-81698504 AATTTAATGGGATATTGATGAGG + Intergenic
1197140677 X:123114452-123114474 AGATTCCTGGGATTAGGATGTGG + Intergenic