ID: 1073036875

View in Genome Browser
Species Human (GRCh38)
Location 10:100570082-100570104
Sequence CAGCCGGGACACTTTCATCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073036875_1073036883 -7 Left 1073036875 10:100570082-100570104 CCGAGATGAAAGTGTCCCGGCTG No data
Right 1073036883 10:100570098-100570120 CCGGCTGGCGGGCAGGCAGGTGG No data
1073036875_1073036884 3 Left 1073036875 10:100570082-100570104 CCGAGATGAAAGTGTCCCGGCTG No data
Right 1073036884 10:100570108-100570130 GGCAGGCAGGTGGCCTCTCCTGG No data
1073036875_1073036880 -10 Left 1073036875 10:100570082-100570104 CCGAGATGAAAGTGTCCCGGCTG No data
Right 1073036880 10:100570095-100570117 GTCCCGGCTGGCGGGCAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073036875 Original CRISPR CAGCCGGGACACTTTCATCT CGG (reversed) Intergenic
No off target data available for this crispr