ID: 1073044502

View in Genome Browser
Species Human (GRCh38)
Location 10:100628812-100628834
Sequence GCTTCCATCCCAACTGGTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073044502_1073044508 21 Left 1073044502 10:100628812-100628834 CCAATACCAGTTGGGATGGAAGC No data
Right 1073044508 10:100628856-100628878 CCTGGTTATATGCTGCCCCCTGG No data
1073044502_1073044506 3 Left 1073044502 10:100628812-100628834 CCAATACCAGTTGGGATGGAAGC No data
Right 1073044506 10:100628838-100628860 AAGGCAGAGTTTAAATCGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073044502 Original CRISPR GCTTCCATCCCAACTGGTAT TGG (reversed) Intergenic
No off target data available for this crispr