ID: 1073045725

View in Genome Browser
Species Human (GRCh38)
Location 10:100637179-100637201
Sequence GATGCTGATGCGACAGGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073045725_1073045730 10 Left 1073045725 10:100637179-100637201 CCTGGACCTGTCGCATCAGCATC No data
Right 1073045730 10:100637212-100637234 CTGTTAGAAATGCAGATTCTTGG No data
1073045725_1073045731 11 Left 1073045725 10:100637179-100637201 CCTGGACCTGTCGCATCAGCATC No data
Right 1073045731 10:100637213-100637235 TGTTAGAAATGCAGATTCTTGGG 0: 32
1: 230
2: 869
3: 1949
4: 3121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073045725 Original CRISPR GATGCTGATGCGACAGGTCC AGG (reversed) Intergenic
No off target data available for this crispr