ID: 1073047315

View in Genome Browser
Species Human (GRCh38)
Location 10:100647298-100647320
Sequence CCCCTAAGGCTGTCACAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073047305_1073047315 11 Left 1073047305 10:100647264-100647286 CCCAAACTCTCACCTCCTCCACA No data
Right 1073047315 10:100647298-100647320 CCCCTAAGGCTGTCACAGACTGG No data
1073047303_1073047315 29 Left 1073047303 10:100647246-100647268 CCAGGTGTGGACCTACTGCCCAA No data
Right 1073047315 10:100647298-100647320 CCCCTAAGGCTGTCACAGACTGG No data
1073047304_1073047315 18 Left 1073047304 10:100647257-100647279 CCTACTGCCCAAACTCTCACCTC No data
Right 1073047315 10:100647298-100647320 CCCCTAAGGCTGTCACAGACTGG No data
1073047307_1073047315 -1 Left 1073047307 10:100647276-100647298 CCTCCTCCACAGTGCCCACCTGC No data
Right 1073047315 10:100647298-100647320 CCCCTAAGGCTGTCACAGACTGG No data
1073047309_1073047315 -7 Left 1073047309 10:100647282-100647304 CCACAGTGCCCACCTGCCCCTAA No data
Right 1073047315 10:100647298-100647320 CCCCTAAGGCTGTCACAGACTGG No data
1073047306_1073047315 10 Left 1073047306 10:100647265-100647287 CCAAACTCTCACCTCCTCCACAG No data
Right 1073047315 10:100647298-100647320 CCCCTAAGGCTGTCACAGACTGG No data
1073047308_1073047315 -4 Left 1073047308 10:100647279-100647301 CCTCCACAGTGCCCACCTGCCCC No data
Right 1073047315 10:100647298-100647320 CCCCTAAGGCTGTCACAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073047315 Original CRISPR CCCCTAAGGCTGTCACAGAC TGG Intergenic
No off target data available for this crispr