ID: 1073048373

View in Genome Browser
Species Human (GRCh38)
Location 10:100653274-100653296
Sequence CCCCAAGCTTCTCCTGCTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073048373_1073048381 13 Left 1073048373 10:100653274-100653296 CCCTTAGCAGGAGAAGCTTGGGG No data
Right 1073048381 10:100653310-100653332 TGAGAGGTCCCCATTCACAGGGG No data
1073048373_1073048382 14 Left 1073048373 10:100653274-100653296 CCCTTAGCAGGAGAAGCTTGGGG No data
Right 1073048382 10:100653311-100653333 GAGAGGTCCCCATTCACAGGGGG No data
1073048373_1073048376 -3 Left 1073048373 10:100653274-100653296 CCCTTAGCAGGAGAAGCTTGGGG No data
Right 1073048376 10:100653294-100653316 GGGTCTTCCTGCCAGCTGAGAGG No data
1073048373_1073048387 27 Left 1073048373 10:100653274-100653296 CCCTTAGCAGGAGAAGCTTGGGG No data
Right 1073048387 10:100653324-100653346 TCACAGGGGGAGACGCTGGATGG No data
1073048373_1073048380 12 Left 1073048373 10:100653274-100653296 CCCTTAGCAGGAGAAGCTTGGGG No data
Right 1073048380 10:100653309-100653331 CTGAGAGGTCCCCATTCACAGGG No data
1073048373_1073048386 23 Left 1073048373 10:100653274-100653296 CCCTTAGCAGGAGAAGCTTGGGG No data
Right 1073048386 10:100653320-100653342 CCATTCACAGGGGGAGACGCTGG No data
1073048373_1073048379 11 Left 1073048373 10:100653274-100653296 CCCTTAGCAGGAGAAGCTTGGGG No data
Right 1073048379 10:100653308-100653330 GCTGAGAGGTCCCCATTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073048373 Original CRISPR CCCCAAGCTTCTCCTGCTAA GGG (reversed) Intergenic