ID: 1073048377

View in Genome Browser
Species Human (GRCh38)
Location 10:100653301-100653323
Sequence ATGGGGACCTCTCAGCTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073048377_1073048391 30 Left 1073048377 10:100653301-100653323 CCTGCCAGCTGAGAGGTCCCCAT No data
Right 1073048391 10:100653354-100653376 TGTGCCCCATGCTGTCCTGGGGG No data
1073048377_1073048389 28 Left 1073048377 10:100653301-100653323 CCTGCCAGCTGAGAGGTCCCCAT No data
Right 1073048389 10:100653352-100653374 ACTGTGCCCCATGCTGTCCTGGG No data
1073048377_1073048388 27 Left 1073048377 10:100653301-100653323 CCTGCCAGCTGAGAGGTCCCCAT No data
Right 1073048388 10:100653351-100653373 GACTGTGCCCCATGCTGTCCTGG No data
1073048377_1073048387 0 Left 1073048377 10:100653301-100653323 CCTGCCAGCTGAGAGGTCCCCAT No data
Right 1073048387 10:100653324-100653346 TCACAGGGGGAGACGCTGGATGG No data
1073048377_1073048390 29 Left 1073048377 10:100653301-100653323 CCTGCCAGCTGAGAGGTCCCCAT No data
Right 1073048390 10:100653353-100653375 CTGTGCCCCATGCTGTCCTGGGG No data
1073048377_1073048386 -4 Left 1073048377 10:100653301-100653323 CCTGCCAGCTGAGAGGTCCCCAT No data
Right 1073048386 10:100653320-100653342 CCATTCACAGGGGGAGACGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073048377 Original CRISPR ATGGGGACCTCTCAGCTGGC AGG (reversed) Intergenic