ID: 1073048378

View in Genome Browser
Species Human (GRCh38)
Location 10:100653305-100653327
Sequence GTGAATGGGGACCTCTCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073048378_1073048390 25 Left 1073048378 10:100653305-100653327 CCAGCTGAGAGGTCCCCATTCAC No data
Right 1073048390 10:100653353-100653375 CTGTGCCCCATGCTGTCCTGGGG No data
1073048378_1073048392 27 Left 1073048378 10:100653305-100653327 CCAGCTGAGAGGTCCCCATTCAC No data
Right 1073048392 10:100653355-100653377 GTGCCCCATGCTGTCCTGGGGGG No data
1073048378_1073048386 -8 Left 1073048378 10:100653305-100653327 CCAGCTGAGAGGTCCCCATTCAC No data
Right 1073048386 10:100653320-100653342 CCATTCACAGGGGGAGACGCTGG No data
1073048378_1073048388 23 Left 1073048378 10:100653305-100653327 CCAGCTGAGAGGTCCCCATTCAC No data
Right 1073048388 10:100653351-100653373 GACTGTGCCCCATGCTGTCCTGG No data
1073048378_1073048387 -4 Left 1073048378 10:100653305-100653327 CCAGCTGAGAGGTCCCCATTCAC No data
Right 1073048387 10:100653324-100653346 TCACAGGGGGAGACGCTGGATGG No data
1073048378_1073048389 24 Left 1073048378 10:100653305-100653327 CCAGCTGAGAGGTCCCCATTCAC No data
Right 1073048389 10:100653352-100653374 ACTGTGCCCCATGCTGTCCTGGG No data
1073048378_1073048391 26 Left 1073048378 10:100653305-100653327 CCAGCTGAGAGGTCCCCATTCAC No data
Right 1073048391 10:100653354-100653376 TGTGCCCCATGCTGTCCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073048378 Original CRISPR GTGAATGGGGACCTCTCAGC TGG (reversed) Intergenic