ID: 1073048384

View in Genome Browser
Species Human (GRCh38)
Location 10:100653319-100653341
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073048384_1073048389 10 Left 1073048384 10:100653319-100653341 CCCATTCACAGGGGGAGACGCTG No data
Right 1073048389 10:100653352-100653374 ACTGTGCCCCATGCTGTCCTGGG No data
1073048384_1073048390 11 Left 1073048384 10:100653319-100653341 CCCATTCACAGGGGGAGACGCTG No data
Right 1073048390 10:100653353-100653375 CTGTGCCCCATGCTGTCCTGGGG No data
1073048384_1073048391 12 Left 1073048384 10:100653319-100653341 CCCATTCACAGGGGGAGACGCTG No data
Right 1073048391 10:100653354-100653376 TGTGCCCCATGCTGTCCTGGGGG No data
1073048384_1073048392 13 Left 1073048384 10:100653319-100653341 CCCATTCACAGGGGGAGACGCTG No data
Right 1073048392 10:100653355-100653377 GTGCCCCATGCTGTCCTGGGGGG No data
1073048384_1073048388 9 Left 1073048384 10:100653319-100653341 CCCATTCACAGGGGGAGACGCTG No data
Right 1073048388 10:100653351-100653373 GACTGTGCCCCATGCTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073048384 Original CRISPR CAGCGTCTCCCCCTGTGAAT GGG (reversed) Intergenic