ID: 1073048386

View in Genome Browser
Species Human (GRCh38)
Location 10:100653320-100653342
Sequence CCATTCACAGGGGGAGACGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073048377_1073048386 -4 Left 1073048377 10:100653301-100653323 CCTGCCAGCTGAGAGGTCCCCAT No data
Right 1073048386 10:100653320-100653342 CCATTCACAGGGGGAGACGCTGG No data
1073048378_1073048386 -8 Left 1073048378 10:100653305-100653327 CCAGCTGAGAGGTCCCCATTCAC No data
Right 1073048386 10:100653320-100653342 CCATTCACAGGGGGAGACGCTGG No data
1073048373_1073048386 23 Left 1073048373 10:100653274-100653296 CCCTTAGCAGGAGAAGCTTGGGG No data
Right 1073048386 10:100653320-100653342 CCATTCACAGGGGGAGACGCTGG No data
1073048375_1073048386 22 Left 1073048375 10:100653275-100653297 CCTTAGCAGGAGAAGCTTGGGGT No data
Right 1073048386 10:100653320-100653342 CCATTCACAGGGGGAGACGCTGG No data
1073048370_1073048386 30 Left 1073048370 10:100653267-100653289 CCTCATTCCCTTAGCAGGAGAAG No data
Right 1073048386 10:100653320-100653342 CCATTCACAGGGGGAGACGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073048386 Original CRISPR CCATTCACAGGGGGAGACGC TGG Intergenic