ID: 1073048390

View in Genome Browser
Species Human (GRCh38)
Location 10:100653353-100653375
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073048377_1073048390 29 Left 1073048377 10:100653301-100653323 CCTGCCAGCTGAGAGGTCCCCAT No data
Right 1073048390 10:100653353-100653375 CTGTGCCCCATGCTGTCCTGGGG No data
1073048385_1073048390 10 Left 1073048385 10:100653320-100653342 CCATTCACAGGGGGAGACGCTGG No data
Right 1073048390 10:100653353-100653375 CTGTGCCCCATGCTGTCCTGGGG No data
1073048383_1073048390 12 Left 1073048383 10:100653318-100653340 CCCCATTCACAGGGGGAGACGCT No data
Right 1073048390 10:100653353-100653375 CTGTGCCCCATGCTGTCCTGGGG No data
1073048384_1073048390 11 Left 1073048384 10:100653319-100653341 CCCATTCACAGGGGGAGACGCTG No data
Right 1073048390 10:100653353-100653375 CTGTGCCCCATGCTGTCCTGGGG No data
1073048378_1073048390 25 Left 1073048378 10:100653305-100653327 CCAGCTGAGAGGTCCCCATTCAC No data
Right 1073048390 10:100653353-100653375 CTGTGCCCCATGCTGTCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073048390 Original CRISPR CTGTGCCCCATGCTGTCCTG GGG Intergenic