ID: 1073051013

View in Genome Browser
Species Human (GRCh38)
Location 10:100667524-100667546
Sequence CGGGCTCCTTTCCCCACTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073051005_1073051013 4 Left 1073051005 10:100667497-100667519 CCTCAGACCCTGCCCTTGCGGAG No data
Right 1073051013 10:100667524-100667546 CGGGCTCCTTTCCCCACTGATGG No data
1073051010_1073051013 -8 Left 1073051010 10:100667509-100667531 CCCTTGCGGAGCCTTCGGGCTCC No data
Right 1073051013 10:100667524-100667546 CGGGCTCCTTTCCCCACTGATGG No data
1073051008_1073051013 -4 Left 1073051008 10:100667505-100667527 CCTGCCCTTGCGGAGCCTTCGGG No data
Right 1073051013 10:100667524-100667546 CGGGCTCCTTTCCCCACTGATGG No data
1073051006_1073051013 -3 Left 1073051006 10:100667504-100667526 CCCTGCCCTTGCGGAGCCTTCGG No data
Right 1073051013 10:100667524-100667546 CGGGCTCCTTTCCCCACTGATGG No data
1073051011_1073051013 -9 Left 1073051011 10:100667510-100667532 CCTTGCGGAGCCTTCGGGCTCCT No data
Right 1073051013 10:100667524-100667546 CGGGCTCCTTTCCCCACTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073051013 Original CRISPR CGGGCTCCTTTCCCCACTGA TGG Intergenic
No off target data available for this crispr