ID: 1073053029

View in Genome Browser
Species Human (GRCh38)
Location 10:100681415-100681437
Sequence CTCCTCCGGAAGCCGGCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073053018_1073053029 30 Left 1073053018 10:100681362-100681384 CCTTGGGAGTTGGGTTGGGGAGC No data
Right 1073053029 10:100681415-100681437 CTCCTCCGGAAGCCGGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073053029 Original CRISPR CTCCTCCGGAAGCCGGCCCA GGG Intergenic
No off target data available for this crispr