ID: 1073053941

View in Genome Browser
Species Human (GRCh38)
Location 10:100687202-100687224
Sequence CCAGGGGACCAGAGGGCAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073053941_1073053956 28 Left 1073053941 10:100687202-100687224 CCAACTGCCCTCTGGTCCCCTGG No data
Right 1073053956 10:100687253-100687275 AACTCCATTAACACTCAATTAGG No data
1073053941_1073053958 30 Left 1073053941 10:100687202-100687224 CCAACTGCCCTCTGGTCCCCTGG No data
Right 1073053958 10:100687255-100687277 CTCCATTAACACTCAATTAGGGG No data
1073053941_1073053957 29 Left 1073053941 10:100687202-100687224 CCAACTGCCCTCTGGTCCCCTGG No data
Right 1073053957 10:100687254-100687276 ACTCCATTAACACTCAATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073053941 Original CRISPR CCAGGGGACCAGAGGGCAGT TGG (reversed) Intergenic
No off target data available for this crispr