ID: 1073054568

View in Genome Browser
Species Human (GRCh38)
Location 10:100690851-100690873
Sequence CAGGAGGATGTGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073054555_1073054568 19 Left 1073054555 10:100690809-100690831 CCTGGGGAGTTTGGGCTATGGTG No data
Right 1073054568 10:100690851-100690873 CAGGAGGATGTGAAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073054568 Original CRISPR CAGGAGGATGTGAAGGAGGA AGG Intergenic
No off target data available for this crispr