ID: 1073056509

View in Genome Browser
Species Human (GRCh38)
Location 10:100706739-100706761
Sequence CTCAGAAAGAGGGGTGTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073056498_1073056509 23 Left 1073056498 10:100706693-100706715 CCGAAGTCCTGCATCCTGGTAGG No data
Right 1073056509 10:100706739-100706761 CTCAGAAAGAGGGGTGTCACTGG No data
1073056502_1073056509 9 Left 1073056502 10:100706707-100706729 CCTGGTAGGCATTTGGAGCATAT No data
Right 1073056509 10:100706739-100706761 CTCAGAAAGAGGGGTGTCACTGG No data
1073056497_1073056509 24 Left 1073056497 10:100706692-100706714 CCCGAAGTCCTGCATCCTGGTAG No data
Right 1073056509 10:100706739-100706761 CTCAGAAAGAGGGGTGTCACTGG No data
1073056500_1073056509 16 Left 1073056500 10:100706700-100706722 CCTGCATCCTGGTAGGCATTTGG No data
Right 1073056509 10:100706739-100706761 CTCAGAAAGAGGGGTGTCACTGG No data
1073056496_1073056509 25 Left 1073056496 10:100706691-100706713 CCCCGAAGTCCTGCATCCTGGTA No data
Right 1073056509 10:100706739-100706761 CTCAGAAAGAGGGGTGTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073056509 Original CRISPR CTCAGAAAGAGGGGTGTCAC TGG Intergenic
No off target data available for this crispr