ID: 1073057124

View in Genome Browser
Species Human (GRCh38)
Location 10:100710049-100710071
Sequence CGCGGGGCGCGGGTTTCTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073057124_1073057138 9 Left 1073057124 10:100710049-100710071 CCGGGAGAAACCCGCGCCCCGCG No data
Right 1073057138 10:100710081-100710103 CCCAGGAGCCCCTCCCTCCGCGG No data
1073057124_1073057148 27 Left 1073057124 10:100710049-100710071 CCGGGAGAAACCCGCGCCCCGCG No data
Right 1073057148 10:100710099-100710121 CGCGGCGCTCCGGGCAGAAGAGG No data
1073057124_1073057141 17 Left 1073057124 10:100710049-100710071 CCGGGAGAAACCCGCGCCCCGCG No data
Right 1073057141 10:100710089-100710111 CCCCTCCCTCCGCGGCGCTCCGG No data
1073057124_1073057127 -8 Left 1073057124 10:100710049-100710071 CCGGGAGAAACCCGCGCCCCGCG No data
Right 1073057127 10:100710064-100710086 GCCCCGCGCCCCCATCCCCCAGG No data
1073057124_1073057143 18 Left 1073057124 10:100710049-100710071 CCGGGAGAAACCCGCGCCCCGCG No data
Right 1073057143 10:100710090-100710112 CCCTCCCTCCGCGGCGCTCCGGG No data
1073057124_1073057149 28 Left 1073057124 10:100710049-100710071 CCGGGAGAAACCCGCGCCCCGCG No data
Right 1073057149 10:100710100-100710122 GCGGCGCTCCGGGCAGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073057124 Original CRISPR CGCGGGGCGCGGGTTTCTCC CGG (reversed) Intergenic