ID: 1073057125

View in Genome Browser
Species Human (GRCh38)
Location 10:100710059-100710081
Sequence GGGATGGGGGCGCGGGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073057125_1073057138 -1 Left 1073057125 10:100710059-100710081 CCCGCGCCCCGCGCCCCCATCCC No data
Right 1073057138 10:100710081-100710103 CCCAGGAGCCCCTCCCTCCGCGG No data
1073057125_1073057148 17 Left 1073057125 10:100710059-100710081 CCCGCGCCCCGCGCCCCCATCCC No data
Right 1073057148 10:100710099-100710121 CGCGGCGCTCCGGGCAGAAGAGG No data
1073057125_1073057149 18 Left 1073057125 10:100710059-100710081 CCCGCGCCCCGCGCCCCCATCCC No data
Right 1073057149 10:100710100-100710122 GCGGCGCTCCGGGCAGAAGAGGG No data
1073057125_1073057141 7 Left 1073057125 10:100710059-100710081 CCCGCGCCCCGCGCCCCCATCCC No data
Right 1073057141 10:100710089-100710111 CCCCTCCCTCCGCGGCGCTCCGG No data
1073057125_1073057143 8 Left 1073057125 10:100710059-100710081 CCCGCGCCCCGCGCCCCCATCCC No data
Right 1073057143 10:100710090-100710112 CCCTCCCTCCGCGGCGCTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073057125 Original CRISPR GGGATGGGGGCGCGGGGCGC GGG (reversed) Intergenic