ID: 1073057128

View in Genome Browser
Species Human (GRCh38)
Location 10:100710065-100710087
Sequence TCCTGGGGGATGGGGGCGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073057128_1073057149 12 Left 1073057128 10:100710065-100710087 CCCCGCGCCCCCATCCCCCAGGA No data
Right 1073057149 10:100710100-100710122 GCGGCGCTCCGGGCAGAAGAGGG No data
1073057128_1073057138 -7 Left 1073057128 10:100710065-100710087 CCCCGCGCCCCCATCCCCCAGGA No data
Right 1073057138 10:100710081-100710103 CCCAGGAGCCCCTCCCTCCGCGG No data
1073057128_1073057148 11 Left 1073057128 10:100710065-100710087 CCCCGCGCCCCCATCCCCCAGGA No data
Right 1073057148 10:100710099-100710121 CGCGGCGCTCCGGGCAGAAGAGG No data
1073057128_1073057151 26 Left 1073057128 10:100710065-100710087 CCCCGCGCCCCCATCCCCCAGGA No data
Right 1073057151 10:100710114-100710136 AGAAGAGGGAAGCAGTGACCCGG No data
1073057128_1073057143 2 Left 1073057128 10:100710065-100710087 CCCCGCGCCCCCATCCCCCAGGA No data
Right 1073057143 10:100710090-100710112 CCCTCCCTCCGCGGCGCTCCGGG No data
1073057128_1073057141 1 Left 1073057128 10:100710065-100710087 CCCCGCGCCCCCATCCCCCAGGA No data
Right 1073057141 10:100710089-100710111 CCCCTCCCTCCGCGGCGCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073057128 Original CRISPR TCCTGGGGGATGGGGGCGCG GGG (reversed) Intergenic