ID: 1073057129

View in Genome Browser
Species Human (GRCh38)
Location 10:100710066-100710088
Sequence CTCCTGGGGGATGGGGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073057129_1073057141 0 Left 1073057129 10:100710066-100710088 CCCGCGCCCCCATCCCCCAGGAG No data
Right 1073057141 10:100710089-100710111 CCCCTCCCTCCGCGGCGCTCCGG No data
1073057129_1073057151 25 Left 1073057129 10:100710066-100710088 CCCGCGCCCCCATCCCCCAGGAG No data
Right 1073057151 10:100710114-100710136 AGAAGAGGGAAGCAGTGACCCGG No data
1073057129_1073057152 30 Left 1073057129 10:100710066-100710088 CCCGCGCCCCCATCCCCCAGGAG No data
Right 1073057152 10:100710119-100710141 AGGGAAGCAGTGACCCGGCCAGG No data
1073057129_1073057143 1 Left 1073057129 10:100710066-100710088 CCCGCGCCCCCATCCCCCAGGAG No data
Right 1073057143 10:100710090-100710112 CCCTCCCTCCGCGGCGCTCCGGG No data
1073057129_1073057148 10 Left 1073057129 10:100710066-100710088 CCCGCGCCCCCATCCCCCAGGAG No data
Right 1073057148 10:100710099-100710121 CGCGGCGCTCCGGGCAGAAGAGG No data
1073057129_1073057138 -8 Left 1073057129 10:100710066-100710088 CCCGCGCCCCCATCCCCCAGGAG No data
Right 1073057138 10:100710081-100710103 CCCAGGAGCCCCTCCCTCCGCGG No data
1073057129_1073057149 11 Left 1073057129 10:100710066-100710088 CCCGCGCCCCCATCCCCCAGGAG No data
Right 1073057149 10:100710100-100710122 GCGGCGCTCCGGGCAGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073057129 Original CRISPR CTCCTGGGGGATGGGGGCGC GGG (reversed) Intergenic