ID: 1073057133

View in Genome Browser
Species Human (GRCh38)
Location 10:100710074-100710096
Sequence GGGAGGGGCTCCTGGGGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073057133_1073057153 25 Left 1073057133 10:100710074-100710096 CCCATCCCCCAGGAGCCCCTCCC No data
Right 1073057153 10:100710122-100710144 GAAGCAGTGACCCGGCCAGGTGG No data
1073057133_1073057148 2 Left 1073057133 10:100710074-100710096 CCCATCCCCCAGGAGCCCCTCCC No data
Right 1073057148 10:100710099-100710121 CGCGGCGCTCCGGGCAGAAGAGG No data
1073057133_1073057152 22 Left 1073057133 10:100710074-100710096 CCCATCCCCCAGGAGCCCCTCCC No data
Right 1073057152 10:100710119-100710141 AGGGAAGCAGTGACCCGGCCAGG No data
1073057133_1073057149 3 Left 1073057133 10:100710074-100710096 CCCATCCCCCAGGAGCCCCTCCC No data
Right 1073057149 10:100710100-100710122 GCGGCGCTCCGGGCAGAAGAGGG No data
1073057133_1073057151 17 Left 1073057133 10:100710074-100710096 CCCATCCCCCAGGAGCCCCTCCC No data
Right 1073057151 10:100710114-100710136 AGAAGAGGGAAGCAGTGACCCGG No data
1073057133_1073057143 -7 Left 1073057133 10:100710074-100710096 CCCATCCCCCAGGAGCCCCTCCC No data
Right 1073057143 10:100710090-100710112 CCCTCCCTCCGCGGCGCTCCGGG No data
1073057133_1073057141 -8 Left 1073057133 10:100710074-100710096 CCCATCCCCCAGGAGCCCCTCCC No data
Right 1073057141 10:100710089-100710111 CCCCTCCCTCCGCGGCGCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073057133 Original CRISPR GGGAGGGGCTCCTGGGGGAT GGG (reversed) Intergenic