ID: 1073057135

View in Genome Browser
Species Human (GRCh38)
Location 10:100710079-100710101
Sequence GCGGAGGGAGGGGCTCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073057135_1073057152 17 Left 1073057135 10:100710079-100710101 CCCCCAGGAGCCCCTCCCTCCGC No data
Right 1073057152 10:100710119-100710141 AGGGAAGCAGTGACCCGGCCAGG No data
1073057135_1073057151 12 Left 1073057135 10:100710079-100710101 CCCCCAGGAGCCCCTCCCTCCGC No data
Right 1073057151 10:100710114-100710136 AGAAGAGGGAAGCAGTGACCCGG No data
1073057135_1073057153 20 Left 1073057135 10:100710079-100710101 CCCCCAGGAGCCCCTCCCTCCGC No data
Right 1073057153 10:100710122-100710144 GAAGCAGTGACCCGGCCAGGTGG No data
1073057135_1073057149 -2 Left 1073057135 10:100710079-100710101 CCCCCAGGAGCCCCTCCCTCCGC No data
Right 1073057149 10:100710100-100710122 GCGGCGCTCCGGGCAGAAGAGGG No data
1073057135_1073057148 -3 Left 1073057135 10:100710079-100710101 CCCCCAGGAGCCCCTCCCTCCGC No data
Right 1073057148 10:100710099-100710121 CGCGGCGCTCCGGGCAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073057135 Original CRISPR GCGGAGGGAGGGGCTCCTGG GGG (reversed) Intergenic