ID: 1073057139

View in Genome Browser
Species Human (GRCh38)
Location 10:100710082-100710104
Sequence GCCGCGGAGGGAGGGGCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073057139_1073057152 14 Left 1073057139 10:100710082-100710104 CCAGGAGCCCCTCCCTCCGCGGC No data
Right 1073057152 10:100710119-100710141 AGGGAAGCAGTGACCCGGCCAGG No data
1073057139_1073057153 17 Left 1073057139 10:100710082-100710104 CCAGGAGCCCCTCCCTCCGCGGC No data
Right 1073057153 10:100710122-100710144 GAAGCAGTGACCCGGCCAGGTGG No data
1073057139_1073057156 28 Left 1073057139 10:100710082-100710104 CCAGGAGCCCCTCCCTCCGCGGC No data
Right 1073057156 10:100710133-100710155 CCGGCCAGGTGGTGATGATGCGG No data
1073057139_1073057148 -6 Left 1073057139 10:100710082-100710104 CCAGGAGCCCCTCCCTCCGCGGC No data
Right 1073057148 10:100710099-100710121 CGCGGCGCTCCGGGCAGAAGAGG No data
1073057139_1073057149 -5 Left 1073057139 10:100710082-100710104 CCAGGAGCCCCTCCCTCCGCGGC No data
Right 1073057149 10:100710100-100710122 GCGGCGCTCCGGGCAGAAGAGGG No data
1073057139_1073057151 9 Left 1073057139 10:100710082-100710104 CCAGGAGCCCCTCCCTCCGCGGC No data
Right 1073057151 10:100710114-100710136 AGAAGAGGGAAGCAGTGACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073057139 Original CRISPR GCCGCGGAGGGAGGGGCTCC TGG (reversed) Intergenic