ID: 1073057141

View in Genome Browser
Species Human (GRCh38)
Location 10:100710089-100710111
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073057125_1073057141 7 Left 1073057125 10:100710059-100710081 CCCGCGCCCCGCGCCCCCATCCC No data
Right 1073057141 10:100710089-100710111 CCCCTCCCTCCGCGGCGCTCCGG No data
1073057132_1073057141 -7 Left 1073057132 10:100710073-100710095 CCCCATCCCCCAGGAGCCCCTCC No data
Right 1073057141 10:100710089-100710111 CCCCTCCCTCCGCGGCGCTCCGG No data
1073057126_1073057141 6 Left 1073057126 10:100710060-100710082 CCGCGCCCCGCGCCCCCATCCCC No data
Right 1073057141 10:100710089-100710111 CCCCTCCCTCCGCGGCGCTCCGG No data
1073057129_1073057141 0 Left 1073057129 10:100710066-100710088 CCCGCGCCCCCATCCCCCAGGAG No data
Right 1073057141 10:100710089-100710111 CCCCTCCCTCCGCGGCGCTCCGG No data
1073057128_1073057141 1 Left 1073057128 10:100710065-100710087 CCCCGCGCCCCCATCCCCCAGGA No data
Right 1073057141 10:100710089-100710111 CCCCTCCCTCCGCGGCGCTCCGG No data
1073057131_1073057141 -6 Left 1073057131 10:100710072-100710094 CCCCCATCCCCCAGGAGCCCCTC No data
Right 1073057141 10:100710089-100710111 CCCCTCCCTCCGCGGCGCTCCGG No data
1073057130_1073057141 -1 Left 1073057130 10:100710067-100710089 CCGCGCCCCCATCCCCCAGGAGC No data
Right 1073057141 10:100710089-100710111 CCCCTCCCTCCGCGGCGCTCCGG No data
1073057133_1073057141 -8 Left 1073057133 10:100710074-100710096 CCCATCCCCCAGGAGCCCCTCCC No data
Right 1073057141 10:100710089-100710111 CCCCTCCCTCCGCGGCGCTCCGG No data
1073057134_1073057141 -9 Left 1073057134 10:100710075-100710097 CCATCCCCCAGGAGCCCCTCCCT No data
Right 1073057141 10:100710089-100710111 CCCCTCCCTCCGCGGCGCTCCGG No data
1073057124_1073057141 17 Left 1073057124 10:100710049-100710071 CCGGGAGAAACCCGCGCCCCGCG No data
Right 1073057141 10:100710089-100710111 CCCCTCCCTCCGCGGCGCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073057141 Original CRISPR CCCCTCCCTCCGCGGCGCTC CGG Intergenic