ID: 1073057149

View in Genome Browser
Species Human (GRCh38)
Location 10:100710100-100710122
Sequence GCGGCGCTCCGGGCAGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073057128_1073057149 12 Left 1073057128 10:100710065-100710087 CCCCGCGCCCCCATCCCCCAGGA No data
Right 1073057149 10:100710100-100710122 GCGGCGCTCCGGGCAGAAGAGGG No data
1073057135_1073057149 -2 Left 1073057135 10:100710079-100710101 CCCCCAGGAGCCCCTCCCTCCGC No data
Right 1073057149 10:100710100-100710122 GCGGCGCTCCGGGCAGAAGAGGG No data
1073057133_1073057149 3 Left 1073057133 10:100710074-100710096 CCCATCCCCCAGGAGCCCCTCCC No data
Right 1073057149 10:100710100-100710122 GCGGCGCTCCGGGCAGAAGAGGG No data
1073057134_1073057149 2 Left 1073057134 10:100710075-100710097 CCATCCCCCAGGAGCCCCTCCCT No data
Right 1073057149 10:100710100-100710122 GCGGCGCTCCGGGCAGAAGAGGG No data
1073057129_1073057149 11 Left 1073057129 10:100710066-100710088 CCCGCGCCCCCATCCCCCAGGAG No data
Right 1073057149 10:100710100-100710122 GCGGCGCTCCGGGCAGAAGAGGG No data
1073057124_1073057149 28 Left 1073057124 10:100710049-100710071 CCGGGAGAAACCCGCGCCCCGCG No data
Right 1073057149 10:100710100-100710122 GCGGCGCTCCGGGCAGAAGAGGG No data
1073057132_1073057149 4 Left 1073057132 10:100710073-100710095 CCCCATCCCCCAGGAGCCCCTCC No data
Right 1073057149 10:100710100-100710122 GCGGCGCTCCGGGCAGAAGAGGG No data
1073057125_1073057149 18 Left 1073057125 10:100710059-100710081 CCCGCGCCCCGCGCCCCCATCCC No data
Right 1073057149 10:100710100-100710122 GCGGCGCTCCGGGCAGAAGAGGG No data
1073057137_1073057149 -4 Left 1073057137 10:100710081-100710103 CCCAGGAGCCCCTCCCTCCGCGG No data
Right 1073057149 10:100710100-100710122 GCGGCGCTCCGGGCAGAAGAGGG No data
1073057136_1073057149 -3 Left 1073057136 10:100710080-100710102 CCCCAGGAGCCCCTCCCTCCGCG No data
Right 1073057149 10:100710100-100710122 GCGGCGCTCCGGGCAGAAGAGGG No data
1073057130_1073057149 10 Left 1073057130 10:100710067-100710089 CCGCGCCCCCATCCCCCAGGAGC No data
Right 1073057149 10:100710100-100710122 GCGGCGCTCCGGGCAGAAGAGGG No data
1073057126_1073057149 17 Left 1073057126 10:100710060-100710082 CCGCGCCCCGCGCCCCCATCCCC No data
Right 1073057149 10:100710100-100710122 GCGGCGCTCCGGGCAGAAGAGGG No data
1073057139_1073057149 -5 Left 1073057139 10:100710082-100710104 CCAGGAGCCCCTCCCTCCGCGGC No data
Right 1073057149 10:100710100-100710122 GCGGCGCTCCGGGCAGAAGAGGG No data
1073057131_1073057149 5 Left 1073057131 10:100710072-100710094 CCCCCATCCCCCAGGAGCCCCTC No data
Right 1073057149 10:100710100-100710122 GCGGCGCTCCGGGCAGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073057149 Original CRISPR GCGGCGCTCCGGGCAGAAGA GGG Intergenic