ID: 1073057221

View in Genome Browser
Species Human (GRCh38)
Location 10:100710384-100710406
Sequence GCGGCTAGGGCGCCCCAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073057221_1073057231 19 Left 1073057221 10:100710384-100710406 CCGGCCTGGGGCGCCCTAGCCGC No data
Right 1073057231 10:100710426-100710448 AGCCACCGACCCCTCCCATGTGG No data
1073057221_1073057239 30 Left 1073057221 10:100710384-100710406 CCGGCCTGGGGCGCCCTAGCCGC No data
Right 1073057239 10:100710437-100710459 CCTCCCATGTGGCCTAGGACGGG No data
1073057221_1073057234 25 Left 1073057221 10:100710384-100710406 CCGGCCTGGGGCGCCCTAGCCGC No data
Right 1073057234 10:100710432-100710454 CGACCCCTCCCATGTGGCCTAGG No data
1073057221_1073057237 29 Left 1073057221 10:100710384-100710406 CCGGCCTGGGGCGCCCTAGCCGC No data
Right 1073057237 10:100710436-100710458 CCCTCCCATGTGGCCTAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073057221 Original CRISPR GCGGCTAGGGCGCCCCAGGC CGG (reversed) Intergenic
No off target data available for this crispr