ID: 1073057226

View in Genome Browser
Species Human (GRCh38)
Location 10:100710398-100710420
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073057226_1073057231 5 Left 1073057226 10:100710398-100710420 CCTAGCCGCTGGTCCTGGCCCAA No data
Right 1073057231 10:100710426-100710448 AGCCACCGACCCCTCCCATGTGG No data
1073057226_1073057241 19 Left 1073057226 10:100710398-100710420 CCTAGCCGCTGGTCCTGGCCCAA No data
Right 1073057241 10:100710440-100710462 CCCATGTGGCCTAGGACGGGAGG No data
1073057226_1073057234 11 Left 1073057226 10:100710398-100710420 CCTAGCCGCTGGTCCTGGCCCAA No data
Right 1073057234 10:100710432-100710454 CGACCCCTCCCATGTGGCCTAGG No data
1073057226_1073057239 16 Left 1073057226 10:100710398-100710420 CCTAGCCGCTGGTCCTGGCCCAA No data
Right 1073057239 10:100710437-100710459 CCTCCCATGTGGCCTAGGACGGG No data
1073057226_1073057237 15 Left 1073057226 10:100710398-100710420 CCTAGCCGCTGGTCCTGGCCCAA No data
Right 1073057237 10:100710436-100710458 CCCTCCCATGTGGCCTAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073057226 Original CRISPR TTGGGCCAGGACCAGCGGCT AGG (reversed) Intergenic
No off target data available for this crispr