ID: 1073057227

View in Genome Browser
Species Human (GRCh38)
Location 10:100710403-100710425
Sequence ACTTGTTGGGCCAGGACCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073057227_1073057237 10 Left 1073057227 10:100710403-100710425 CCGCTGGTCCTGGCCCAACAAGT No data
Right 1073057237 10:100710436-100710458 CCCTCCCATGTGGCCTAGGACGG No data
1073057227_1073057244 27 Left 1073057227 10:100710403-100710425 CCGCTGGTCCTGGCCCAACAAGT No data
Right 1073057244 10:100710453-100710475 GGACGGGAGGAGCTTCTGCCCGG No data
1073057227_1073057231 0 Left 1073057227 10:100710403-100710425 CCGCTGGTCCTGGCCCAACAAGT No data
Right 1073057231 10:100710426-100710448 AGCCACCGACCCCTCCCATGTGG No data
1073057227_1073057234 6 Left 1073057227 10:100710403-100710425 CCGCTGGTCCTGGCCCAACAAGT No data
Right 1073057234 10:100710432-100710454 CGACCCCTCCCATGTGGCCTAGG No data
1073057227_1073057239 11 Left 1073057227 10:100710403-100710425 CCGCTGGTCCTGGCCCAACAAGT No data
Right 1073057239 10:100710437-100710459 CCTCCCATGTGGCCTAGGACGGG No data
1073057227_1073057241 14 Left 1073057227 10:100710403-100710425 CCGCTGGTCCTGGCCCAACAAGT No data
Right 1073057241 10:100710440-100710462 CCCATGTGGCCTAGGACGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073057227 Original CRISPR ACTTGTTGGGCCAGGACCAG CGG (reversed) Intergenic
No off target data available for this crispr