ID: 1073057228

View in Genome Browser
Species Human (GRCh38)
Location 10:100710411-100710433
Sequence CGGTGGCTACTTGTTGGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073057228_1073057241 6 Left 1073057228 10:100710411-100710433 CCTGGCCCAACAAGTAGCCACCG No data
Right 1073057241 10:100710440-100710462 CCCATGTGGCCTAGGACGGGAGG No data
1073057228_1073057246 27 Left 1073057228 10:100710411-100710433 CCTGGCCCAACAAGTAGCCACCG No data
Right 1073057246 10:100710461-100710483 GGAGCTTCTGCCCGGCAGTTGGG No data
1073057228_1073057245 26 Left 1073057228 10:100710411-100710433 CCTGGCCCAACAAGTAGCCACCG No data
Right 1073057245 10:100710460-100710482 AGGAGCTTCTGCCCGGCAGTTGG No data
1073057228_1073057231 -8 Left 1073057228 10:100710411-100710433 CCTGGCCCAACAAGTAGCCACCG No data
Right 1073057231 10:100710426-100710448 AGCCACCGACCCCTCCCATGTGG No data
1073057228_1073057248 29 Left 1073057228 10:100710411-100710433 CCTGGCCCAACAAGTAGCCACCG No data
Right 1073057248 10:100710463-100710485 AGCTTCTGCCCGGCAGTTGGGGG No data
1073057228_1073057247 28 Left 1073057228 10:100710411-100710433 CCTGGCCCAACAAGTAGCCACCG No data
Right 1073057247 10:100710462-100710484 GAGCTTCTGCCCGGCAGTTGGGG No data
1073057228_1073057239 3 Left 1073057228 10:100710411-100710433 CCTGGCCCAACAAGTAGCCACCG No data
Right 1073057239 10:100710437-100710459 CCTCCCATGTGGCCTAGGACGGG No data
1073057228_1073057237 2 Left 1073057228 10:100710411-100710433 CCTGGCCCAACAAGTAGCCACCG No data
Right 1073057237 10:100710436-100710458 CCCTCCCATGTGGCCTAGGACGG No data
1073057228_1073057244 19 Left 1073057228 10:100710411-100710433 CCTGGCCCAACAAGTAGCCACCG No data
Right 1073057244 10:100710453-100710475 GGACGGGAGGAGCTTCTGCCCGG No data
1073057228_1073057234 -2 Left 1073057228 10:100710411-100710433 CCTGGCCCAACAAGTAGCCACCG No data
Right 1073057234 10:100710432-100710454 CGACCCCTCCCATGTGGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073057228 Original CRISPR CGGTGGCTACTTGTTGGGCC AGG (reversed) Intergenic
No off target data available for this crispr