ID: 1073057231

View in Genome Browser
Species Human (GRCh38)
Location 10:100710426-100710448
Sequence AGCCACCGACCCCTCCCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073057228_1073057231 -8 Left 1073057228 10:100710411-100710433 CCTGGCCCAACAAGTAGCCACCG No data
Right 1073057231 10:100710426-100710448 AGCCACCGACCCCTCCCATGTGG No data
1073057221_1073057231 19 Left 1073057221 10:100710384-100710406 CCGGCCTGGGGCGCCCTAGCCGC No data
Right 1073057231 10:100710426-100710448 AGCCACCGACCCCTCCCATGTGG No data
1073057219_1073057231 24 Left 1073057219 10:100710379-100710401 CCCAGCCGGCCTGGGGCGCCCTA No data
Right 1073057231 10:100710426-100710448 AGCCACCGACCCCTCCCATGTGG No data
1073057220_1073057231 23 Left 1073057220 10:100710380-100710402 CCAGCCGGCCTGGGGCGCCCTAG No data
Right 1073057231 10:100710426-100710448 AGCCACCGACCCCTCCCATGTGG No data
1073057225_1073057231 6 Left 1073057225 10:100710397-100710419 CCCTAGCCGCTGGTCCTGGCCCA No data
Right 1073057231 10:100710426-100710448 AGCCACCGACCCCTCCCATGTGG No data
1073057223_1073057231 15 Left 1073057223 10:100710388-100710410 CCTGGGGCGCCCTAGCCGCTGGT No data
Right 1073057231 10:100710426-100710448 AGCCACCGACCCCTCCCATGTGG No data
1073057227_1073057231 0 Left 1073057227 10:100710403-100710425 CCGCTGGTCCTGGCCCAACAAGT No data
Right 1073057231 10:100710426-100710448 AGCCACCGACCCCTCCCATGTGG No data
1073057218_1073057231 28 Left 1073057218 10:100710375-100710397 CCAGCCCAGCCGGCCTGGGGCGC No data
Right 1073057231 10:100710426-100710448 AGCCACCGACCCCTCCCATGTGG No data
1073057226_1073057231 5 Left 1073057226 10:100710398-100710420 CCTAGCCGCTGGTCCTGGCCCAA No data
Right 1073057231 10:100710426-100710448 AGCCACCGACCCCTCCCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073057231 Original CRISPR AGCCACCGACCCCTCCCATG TGG Intergenic
No off target data available for this crispr