ID: 1073057237

View in Genome Browser
Species Human (GRCh38)
Location 10:100710436-100710458
Sequence CCCTCCCATGTGGCCTAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073057223_1073057237 25 Left 1073057223 10:100710388-100710410 CCTGGGGCGCCCTAGCCGCTGGT No data
Right 1073057237 10:100710436-100710458 CCCTCCCATGTGGCCTAGGACGG No data
1073057227_1073057237 10 Left 1073057227 10:100710403-100710425 CCGCTGGTCCTGGCCCAACAAGT No data
Right 1073057237 10:100710436-100710458 CCCTCCCATGTGGCCTAGGACGG No data
1073057229_1073057237 -3 Left 1073057229 10:100710416-100710438 CCCAACAAGTAGCCACCGACCCC No data
Right 1073057237 10:100710436-100710458 CCCTCCCATGTGGCCTAGGACGG No data
1073057226_1073057237 15 Left 1073057226 10:100710398-100710420 CCTAGCCGCTGGTCCTGGCCCAA No data
Right 1073057237 10:100710436-100710458 CCCTCCCATGTGGCCTAGGACGG No data
1073057230_1073057237 -4 Left 1073057230 10:100710417-100710439 CCAACAAGTAGCCACCGACCCCT No data
Right 1073057237 10:100710436-100710458 CCCTCCCATGTGGCCTAGGACGG No data
1073057225_1073057237 16 Left 1073057225 10:100710397-100710419 CCCTAGCCGCTGGTCCTGGCCCA No data
Right 1073057237 10:100710436-100710458 CCCTCCCATGTGGCCTAGGACGG No data
1073057221_1073057237 29 Left 1073057221 10:100710384-100710406 CCGGCCTGGGGCGCCCTAGCCGC No data
Right 1073057237 10:100710436-100710458 CCCTCCCATGTGGCCTAGGACGG No data
1073057228_1073057237 2 Left 1073057228 10:100710411-100710433 CCTGGCCCAACAAGTAGCCACCG No data
Right 1073057237 10:100710436-100710458 CCCTCCCATGTGGCCTAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073057237 Original CRISPR CCCTCCCATGTGGCCTAGGA CGG Intergenic
No off target data available for this crispr