ID: 1073057244

View in Genome Browser
Species Human (GRCh38)
Location 10:100710453-100710475
Sequence GGACGGGAGGAGCTTCTGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073057229_1073057244 14 Left 1073057229 10:100710416-100710438 CCCAACAAGTAGCCACCGACCCC No data
Right 1073057244 10:100710453-100710475 GGACGGGAGGAGCTTCTGCCCGG No data
1073057236_1073057244 -6 Left 1073057236 10:100710436-100710458 CCCTCCCATGTGGCCTAGGACGG No data
Right 1073057244 10:100710453-100710475 GGACGGGAGGAGCTTCTGCCCGG No data
1073057233_1073057244 -1 Left 1073057233 10:100710431-100710453 CCGACCCCTCCCATGTGGCCTAG No data
Right 1073057244 10:100710453-100710475 GGACGGGAGGAGCTTCTGCCCGG No data
1073057230_1073057244 13 Left 1073057230 10:100710417-100710439 CCAACAAGTAGCCACCGACCCCT No data
Right 1073057244 10:100710453-100710475 GGACGGGAGGAGCTTCTGCCCGG No data
1073057235_1073057244 -5 Left 1073057235 10:100710435-100710457 CCCCTCCCATGTGGCCTAGGACG No data
Right 1073057244 10:100710453-100710475 GGACGGGAGGAGCTTCTGCCCGG No data
1073057227_1073057244 27 Left 1073057227 10:100710403-100710425 CCGCTGGTCCTGGCCCAACAAGT No data
Right 1073057244 10:100710453-100710475 GGACGGGAGGAGCTTCTGCCCGG No data
1073057238_1073057244 -7 Left 1073057238 10:100710437-100710459 CCTCCCATGTGGCCTAGGACGGG No data
Right 1073057244 10:100710453-100710475 GGACGGGAGGAGCTTCTGCCCGG No data
1073057228_1073057244 19 Left 1073057228 10:100710411-100710433 CCTGGCCCAACAAGTAGCCACCG No data
Right 1073057244 10:100710453-100710475 GGACGGGAGGAGCTTCTGCCCGG No data
1073057232_1073057244 2 Left 1073057232 10:100710428-100710450 CCACCGACCCCTCCCATGTGGCC No data
Right 1073057244 10:100710453-100710475 GGACGGGAGGAGCTTCTGCCCGG No data
1073057240_1073057244 -10 Left 1073057240 10:100710440-100710462 CCCATGTGGCCTAGGACGGGAGG No data
Right 1073057244 10:100710453-100710475 GGACGGGAGGAGCTTCTGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073057244 Original CRISPR GGACGGGAGGAGCTTCTGCC CGG Intergenic
No off target data available for this crispr