ID: 1073057247

View in Genome Browser
Species Human (GRCh38)
Location 10:100710462-100710484
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073057228_1073057247 28 Left 1073057228 10:100710411-100710433 CCTGGCCCAACAAGTAGCCACCG No data
Right 1073057247 10:100710462-100710484 GAGCTTCTGCCCGGCAGTTGGGG No data
1073057235_1073057247 4 Left 1073057235 10:100710435-100710457 CCCCTCCCATGTGGCCTAGGACG No data
Right 1073057247 10:100710462-100710484 GAGCTTCTGCCCGGCAGTTGGGG No data
1073057236_1073057247 3 Left 1073057236 10:100710436-100710458 CCCTCCCATGTGGCCTAGGACGG No data
Right 1073057247 10:100710462-100710484 GAGCTTCTGCCCGGCAGTTGGGG No data
1073057242_1073057247 -2 Left 1073057242 10:100710441-100710463 CCATGTGGCCTAGGACGGGAGGA No data
Right 1073057247 10:100710462-100710484 GAGCTTCTGCCCGGCAGTTGGGG No data
1073057233_1073057247 8 Left 1073057233 10:100710431-100710453 CCGACCCCTCCCATGTGGCCTAG No data
Right 1073057247 10:100710462-100710484 GAGCTTCTGCCCGGCAGTTGGGG No data
1073057238_1073057247 2 Left 1073057238 10:100710437-100710459 CCTCCCATGTGGCCTAGGACGGG No data
Right 1073057247 10:100710462-100710484 GAGCTTCTGCCCGGCAGTTGGGG No data
1073057229_1073057247 23 Left 1073057229 10:100710416-100710438 CCCAACAAGTAGCCACCGACCCC No data
Right 1073057247 10:100710462-100710484 GAGCTTCTGCCCGGCAGTTGGGG No data
1073057230_1073057247 22 Left 1073057230 10:100710417-100710439 CCAACAAGTAGCCACCGACCCCT No data
Right 1073057247 10:100710462-100710484 GAGCTTCTGCCCGGCAGTTGGGG No data
1073057243_1073057247 -10 Left 1073057243 10:100710449-100710471 CCTAGGACGGGAGGAGCTTCTGC No data
Right 1073057247 10:100710462-100710484 GAGCTTCTGCCCGGCAGTTGGGG No data
1073057240_1073057247 -1 Left 1073057240 10:100710440-100710462 CCCATGTGGCCTAGGACGGGAGG No data
Right 1073057247 10:100710462-100710484 GAGCTTCTGCCCGGCAGTTGGGG No data
1073057232_1073057247 11 Left 1073057232 10:100710428-100710450 CCACCGACCCCTCCCATGTGGCC No data
Right 1073057247 10:100710462-100710484 GAGCTTCTGCCCGGCAGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073057247 Original CRISPR GAGCTTCTGCCCGGCAGTTG GGG Intergenic
No off target data available for this crispr