ID: 1073057942

View in Genome Browser
Species Human (GRCh38)
Location 10:100714044-100714066
Sequence GGGGGTACACGCAGGGGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073057937_1073057942 -6 Left 1073057937 10:100714027-100714049 CCTGGGACTCCGCTGGTGGGGGT No data
Right 1073057942 10:100714044-100714066 GGGGGTACACGCAGGGGCACTGG No data
1073057926_1073057942 24 Left 1073057926 10:100713997-100714019 CCGCAGCGGAGGTGGGACTGGGG No data
Right 1073057942 10:100714044-100714066 GGGGGTACACGCAGGGGCACTGG No data
1073057924_1073057942 25 Left 1073057924 10:100713996-100714018 CCCGCAGCGGAGGTGGGACTGGG No data
Right 1073057942 10:100714044-100714066 GGGGGTACACGCAGGGGCACTGG No data
1073057922_1073057942 30 Left 1073057922 10:100713991-100714013 CCTGGCCCGCAGCGGAGGTGGGA No data
Right 1073057942 10:100714044-100714066 GGGGGTACACGCAGGGGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073057942 Original CRISPR GGGGGTACACGCAGGGGCAC TGG Intergenic