ID: 1073059543

View in Genome Browser
Species Human (GRCh38)
Location 10:100725074-100725096
Sequence GTGTGTATGGGGGAGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073059543_1073059553 -4 Left 1073059543 10:100725074-100725096 CCCTCCCCCTCCCCCATACACAC No data
Right 1073059553 10:100725093-100725115 ACACAACACTTTTCCTTGACAGG No data
1073059543_1073059554 6 Left 1073059543 10:100725074-100725096 CCCTCCCCCTCCCCCATACACAC No data
Right 1073059554 10:100725103-100725125 TTTCCTTGACAGGAAGAGCCAGG No data
1073059543_1073059558 11 Left 1073059543 10:100725074-100725096 CCCTCCCCCTCCCCCATACACAC No data
Right 1073059558 10:100725108-100725130 TTGACAGGAAGAGCCAGGGAGGG No data
1073059543_1073059559 12 Left 1073059543 10:100725074-100725096 CCCTCCCCCTCCCCCATACACAC No data
Right 1073059559 10:100725109-100725131 TGACAGGAAGAGCCAGGGAGGGG No data
1073059543_1073059557 10 Left 1073059543 10:100725074-100725096 CCCTCCCCCTCCCCCATACACAC No data
Right 1073059557 10:100725107-100725129 CTTGACAGGAAGAGCCAGGGAGG No data
1073059543_1073059555 7 Left 1073059543 10:100725074-100725096 CCCTCCCCCTCCCCCATACACAC No data
Right 1073059555 10:100725104-100725126 TTCCTTGACAGGAAGAGCCAGGG No data
1073059543_1073059560 15 Left 1073059543 10:100725074-100725096 CCCTCCCCCTCCCCCATACACAC No data
Right 1073059560 10:100725112-100725134 CAGGAAGAGCCAGGGAGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073059543 Original CRISPR GTGTGTATGGGGGAGGGGGA GGG (reversed) Intergenic
No off target data available for this crispr