ID: 1073059707

View in Genome Browser
Species Human (GRCh38)
Location 10:100726140-100726162
Sequence GATCCTGATGGGCCACATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073059707_1073059716 19 Left 1073059707 10:100726140-100726162 CCTGCATGTGGCCCATCAGGATC No data
Right 1073059716 10:100726182-100726204 GTGGCTGGTGTTGAGGATCAGGG No data
1073059707_1073059712 0 Left 1073059707 10:100726140-100726162 CCTGCATGTGGCCCATCAGGATC No data
Right 1073059712 10:100726163-100726185 TGTCTAGGGAATTCTTGCTGTGG No data
1073059707_1073059717 29 Left 1073059707 10:100726140-100726162 CCTGCATGTGGCCCATCAGGATC No data
Right 1073059717 10:100726192-100726214 TTGAGGATCAGGGCCCACTTAGG No data
1073059707_1073059715 18 Left 1073059707 10:100726140-100726162 CCTGCATGTGGCCCATCAGGATC No data
Right 1073059715 10:100726181-100726203 TGTGGCTGGTGTTGAGGATCAGG No data
1073059707_1073059714 12 Left 1073059707 10:100726140-100726162 CCTGCATGTGGCCCATCAGGATC No data
Right 1073059714 10:100726175-100726197 TCTTGCTGTGGCTGGTGTTGAGG No data
1073059707_1073059713 4 Left 1073059707 10:100726140-100726162 CCTGCATGTGGCCCATCAGGATC No data
Right 1073059713 10:100726167-100726189 TAGGGAATTCTTGCTGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073059707 Original CRISPR GATCCTGATGGGCCACATGC AGG (reversed) Intergenic
No off target data available for this crispr