ID: 1073061297

View in Genome Browser
Species Human (GRCh38)
Location 10:100735392-100735414
Sequence GCAGCCACCCTCGCTGCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073061297_1073061306 26 Left 1073061297 10:100735392-100735414 CCTCAGGCAGCGAGGGTGGCTGC No data
Right 1073061306 10:100735441-100735463 TGCGTGTGCACGCGTGTGCGCGG No data
1073061297_1073061300 -5 Left 1073061297 10:100735392-100735414 CCTCAGGCAGCGAGGGTGGCTGC No data
Right 1073061300 10:100735410-100735432 GCTGCTTGCCTGCGGCTGGCTGG No data
1073061297_1073061304 3 Left 1073061297 10:100735392-100735414 CCTCAGGCAGCGAGGGTGGCTGC No data
Right 1073061304 10:100735418-100735440 CCTGCGGCTGGCTGGGGCCTCGG No data
1073061297_1073061301 -4 Left 1073061297 10:100735392-100735414 CCTCAGGCAGCGAGGGTGGCTGC No data
Right 1073061301 10:100735411-100735433 CTGCTTGCCTGCGGCTGGCTGGG No data
1073061297_1073061307 27 Left 1073061297 10:100735392-100735414 CCTCAGGCAGCGAGGGTGGCTGC No data
Right 1073061307 10:100735442-100735464 GCGTGTGCACGCGTGTGCGCGGG No data
1073061297_1073061299 -9 Left 1073061297 10:100735392-100735414 CCTCAGGCAGCGAGGGTGGCTGC No data
Right 1073061299 10:100735406-100735428 GGTGGCTGCTTGCCTGCGGCTGG No data
1073061297_1073061302 -3 Left 1073061297 10:100735392-100735414 CCTCAGGCAGCGAGGGTGGCTGC No data
Right 1073061302 10:100735412-100735434 TGCTTGCCTGCGGCTGGCTGGGG No data
1073061297_1073061308 28 Left 1073061297 10:100735392-100735414 CCTCAGGCAGCGAGGGTGGCTGC No data
Right 1073061308 10:100735443-100735465 CGTGTGCACGCGTGTGCGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073061297 Original CRISPR GCAGCCACCCTCGCTGCCTG AGG (reversed) Intergenic
No off target data available for this crispr