ID: 1073061303

View in Genome Browser
Species Human (GRCh38)
Location 10:100735418-100735440
Sequence CCGAGGCCCCAGCCAGCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073061303_1073061306 0 Left 1073061303 10:100735418-100735440 CCTGCGGCTGGCTGGGGCCTCGG No data
Right 1073061306 10:100735441-100735463 TGCGTGTGCACGCGTGTGCGCGG No data
1073061303_1073061310 14 Left 1073061303 10:100735418-100735440 CCTGCGGCTGGCTGGGGCCTCGG No data
Right 1073061310 10:100735455-100735477 TGTGCGCGGGGCGGAGAACCCGG No data
1073061303_1073061308 2 Left 1073061303 10:100735418-100735440 CCTGCGGCTGGCTGGGGCCTCGG No data
Right 1073061308 10:100735443-100735465 CGTGTGCACGCGTGTGCGCGGGG No data
1073061303_1073061313 24 Left 1073061303 10:100735418-100735440 CCTGCGGCTGGCTGGGGCCTCGG No data
Right 1073061313 10:100735465-100735487 GCGGAGAACCCGGGCTCCTCGGG No data
1073061303_1073061312 23 Left 1073061303 10:100735418-100735440 CCTGCGGCTGGCTGGGGCCTCGG No data
Right 1073061312 10:100735464-100735486 GGCGGAGAACCCGGGCTCCTCGG No data
1073061303_1073061314 25 Left 1073061303 10:100735418-100735440 CCTGCGGCTGGCTGGGGCCTCGG No data
Right 1073061314 10:100735466-100735488 CGGAGAACCCGGGCTCCTCGGGG No data
1073061303_1073061309 5 Left 1073061303 10:100735418-100735440 CCTGCGGCTGGCTGGGGCCTCGG No data
Right 1073061309 10:100735446-100735468 GTGCACGCGTGTGCGCGGGGCGG No data
1073061303_1073061307 1 Left 1073061303 10:100735418-100735440 CCTGCGGCTGGCTGGGGCCTCGG No data
Right 1073061307 10:100735442-100735464 GCGTGTGCACGCGTGTGCGCGGG No data
1073061303_1073061311 15 Left 1073061303 10:100735418-100735440 CCTGCGGCTGGCTGGGGCCTCGG No data
Right 1073061311 10:100735456-100735478 GTGCGCGGGGCGGAGAACCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073061303 Original CRISPR CCGAGGCCCCAGCCAGCCGC AGG (reversed) Intergenic
No off target data available for this crispr