ID: 1073061307

View in Genome Browser
Species Human (GRCh38)
Location 10:100735442-100735464
Sequence GCGTGTGCACGCGTGTGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073061297_1073061307 27 Left 1073061297 10:100735392-100735414 CCTCAGGCAGCGAGGGTGGCTGC No data
Right 1073061307 10:100735442-100735464 GCGTGTGCACGCGTGTGCGCGGG No data
1073061303_1073061307 1 Left 1073061303 10:100735418-100735440 CCTGCGGCTGGCTGGGGCCTCGG No data
Right 1073061307 10:100735442-100735464 GCGTGTGCACGCGTGTGCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073061307 Original CRISPR GCGTGTGCACGCGTGTGCGC GGG Intergenic
No off target data available for this crispr