ID: 1073063765

View in Genome Browser
Species Human (GRCh38)
Location 10:100746617-100746639
Sequence CTGACTAGGGAGAGGGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 0, 2: 0, 3: 44, 4: 319}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073063765_1073063773 -5 Left 1073063765 10:100746617-100746639 CCAGCCACCCTCTCCCTAGTCAG 0: 1
1: 0
2: 0
3: 44
4: 319
Right 1073063773 10:100746635-100746657 GTCAGCCTCTTGCCCTGGGCTGG No data
1073063765_1073063781 11 Left 1073063765 10:100746617-100746639 CCAGCCACCCTCTCCCTAGTCAG 0: 1
1: 0
2: 0
3: 44
4: 319
Right 1073063781 10:100746651-100746673 GGGCTGGGGGGCAAATTAGCAGG No data
1073063765_1073063777 -1 Left 1073063765 10:100746617-100746639 CCAGCCACCCTCTCCCTAGTCAG 0: 1
1: 0
2: 0
3: 44
4: 319
Right 1073063777 10:100746639-100746661 GCCTCTTGCCCTGGGCTGGGGGG No data
1073063765_1073063775 -3 Left 1073063765 10:100746617-100746639 CCAGCCACCCTCTCCCTAGTCAG 0: 1
1: 0
2: 0
3: 44
4: 319
Right 1073063775 10:100746637-100746659 CAGCCTCTTGCCCTGGGCTGGGG No data
1073063765_1073063783 23 Left 1073063765 10:100746617-100746639 CCAGCCACCCTCTCCCTAGTCAG 0: 1
1: 0
2: 0
3: 44
4: 319
Right 1073063783 10:100746663-100746685 AAATTAGCAGGCAGTTTTCAGGG No data
1073063765_1073063782 22 Left 1073063765 10:100746617-100746639 CCAGCCACCCTCTCCCTAGTCAG 0: 1
1: 0
2: 0
3: 44
4: 319
Right 1073063782 10:100746662-100746684 CAAATTAGCAGGCAGTTTTCAGG No data
1073063765_1073063770 -10 Left 1073063765 10:100746617-100746639 CCAGCCACCCTCTCCCTAGTCAG 0: 1
1: 0
2: 0
3: 44
4: 319
Right 1073063770 10:100746630-100746652 CCCTAGTCAGCCTCTTGCCCTGG No data
1073063765_1073063774 -4 Left 1073063765 10:100746617-100746639 CCAGCCACCCTCTCCCTAGTCAG 0: 1
1: 0
2: 0
3: 44
4: 319
Right 1073063774 10:100746636-100746658 TCAGCCTCTTGCCCTGGGCTGGG No data
1073063765_1073063776 -2 Left 1073063765 10:100746617-100746639 CCAGCCACCCTCTCCCTAGTCAG 0: 1
1: 0
2: 0
3: 44
4: 319
Right 1073063776 10:100746638-100746660 AGCCTCTTGCCCTGGGCTGGGGG No data
1073063765_1073063772 -9 Left 1073063765 10:100746617-100746639 CCAGCCACCCTCTCCCTAGTCAG 0: 1
1: 0
2: 0
3: 44
4: 319
Right 1073063772 10:100746631-100746653 CCTAGTCAGCCTCTTGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073063765 Original CRISPR CTGACTAGGGAGAGGGTGGC TGG (reversed) Intronic
900409129 1:2504929-2504951 CCGGCTGGGGAGGGGGTGGCAGG + Exonic
900546651 1:3233193-3233215 CTGCCCAGGGTGGGGGTGGCCGG + Intronic
900653870 1:3745398-3745420 CTGAGTCGGGAGAGGGAGGCTGG - Intergenic
900690442 1:3977498-3977520 GTGACAAGGGAGAAGGTGGAAGG + Intergenic
900998666 1:6136479-6136501 CTGGCTAGGGAGGTGGTGGTGGG - Intronic
901758488 1:11455722-11455744 TGGGCTAGGGAGAGGGTGGCGGG - Intergenic
902393400 1:16119139-16119161 CTGCCTGGGGAGAGGGTGCCAGG + Intergenic
902667313 1:17948657-17948679 CATGCTCGGGAGAGGGTGGCGGG - Intergenic
902721383 1:18306593-18306615 CTGACTAGGGAGGGGCTGCCTGG - Intronic
903059773 1:20661670-20661692 CAGACTAGGGGGCGGGAGGCCGG - Intergenic
905282833 1:36860078-36860100 CTGATTAGGGAGTGGGTAGGAGG - Intronic
905695036 1:39967785-39967807 CTGACTAGGGAAGGGGGTGCAGG - Exonic
906101455 1:43266384-43266406 CTGAGAAGGGAGTGGGTGCCTGG + Intronic
906380464 1:45329054-45329076 GGGGCTAGGGAGAGGGTGGAAGG + Intergenic
906685438 1:47760303-47760325 CTGGCTGGGGAGAGGGTATCTGG + Intergenic
907272583 1:53299521-53299543 CTCACCAGGGAGTGTGTGGCAGG + Intronic
907440577 1:54475825-54475847 CTTACTAGGGTGAGGGTGGGTGG - Intergenic
907704476 1:56820550-56820572 CTGACCAGGGAGAGGCGGGGTGG + Intergenic
908313605 1:62910557-62910579 GTGACTAGGGAGAGAGTAGAAGG - Intergenic
908416047 1:63914385-63914407 CTTCCTAGGGAGAGGAAGGCAGG + Intronic
909016531 1:70385890-70385912 GTGTCTAGGGAGAGGCTGGTAGG - Intergenic
910236126 1:85038141-85038163 CAGCCTAGGGAGTGGGTGGGAGG + Intronic
911710539 1:101066656-101066678 ATGAGAAGGGAGAGAGTGGCAGG + Intergenic
912475512 1:109932131-109932153 ATGACAAGGGACAGGGTGGCAGG - Intergenic
912487332 1:110039534-110039556 CTGAGTAGGGAAGGGGAGGCTGG + Intronic
916079460 1:161223422-161223444 CGGCCTAGGAAGAGGGTGGTGGG + Exonic
917616190 1:176747154-176747176 ATGATTTGAGAGAGGGTGGCAGG - Intronic
917803383 1:178591398-178591420 CTGGCTAGGGAGAGGAGGCCAGG + Intergenic
918315014 1:183316264-183316286 ATGAAGAGGGAAAGGGTGGCAGG + Intronic
918477030 1:184935942-184935964 CAGACTAGTGAGAGAGTTGCAGG + Intronic
919801795 1:201358867-201358889 CTAGCTGGGGAGAGGGTGGAGGG - Intergenic
922091817 1:222402822-222402844 CTGAGTGGGGAGGTGGTGGCTGG - Intergenic
923300492 1:232635719-232635741 ATGAATAGGGAGTGGGTGGATGG + Intergenic
923516026 1:234698669-234698691 CTAGCTAGAGGGAGGGTGGCAGG - Intergenic
923536656 1:234857782-234857804 GGGAGTAGGGAGAGGGTGGCTGG + Intergenic
924003693 1:239583033-239583055 GTGACAAGGAAGATGGTGGCTGG - Intronic
1064254139 10:13729660-13729682 CTGCTTAGGGACAGGGGGGCAGG + Intronic
1064700349 10:18012570-18012592 CAGACTATTGAAAGGGTGGCTGG + Intronic
1067781694 10:49212412-49212434 GGGAGTAGGGAGAGGGAGGCAGG - Intergenic
1070214480 10:74362983-74363005 CTGACTACAAAGAGAGTGGCTGG + Intronic
1070553814 10:77513098-77513120 CTGGGTAGGGGGAGGCTGGCAGG - Intronic
1070718114 10:78737190-78737212 CTGCCCAGGGAGAGAGTGGCAGG + Intergenic
1073063765 10:100746617-100746639 CTGACTAGGGAGAGGGTGGCTGG - Intronic
1073292420 10:102419821-102419843 CTGCTTAGGGAGGGGGTAGCTGG - Exonic
1073677519 10:105665253-105665275 CTGACAAACGAGAGGGTGGAGGG + Intergenic
1074223252 10:111459219-111459241 TTCGCTAAGGAGAGGGTGGCTGG + Intergenic
1074289875 10:112130422-112130444 CTTGCAAGGGAGGGGGTGGCAGG + Intergenic
1074606418 10:114973340-114973362 TTGACTAGGGAGAGTGTAACGGG + Intronic
1075106423 10:119542791-119542813 CTGGCTAGGAGGAGGGCGGCGGG - Intergenic
1075214354 10:120519185-120519207 CTGACAAGTGAGTGGGTGTCAGG - Intronic
1075626785 10:123969607-123969629 CTGTCTAGGGGTAGGGGGGCGGG + Intergenic
1075845812 10:125544388-125544410 CTGACTCTGGAGAGTGTGGGGGG + Intergenic
1076093771 10:127713666-127713688 CTGACCAGGGAGCAGGTGGGCGG - Intergenic
1076322662 10:129594962-129594984 TTGACTGGGGAGAGGGGAGCCGG + Intronic
1076409493 10:130235696-130235718 ATGGCTAGGGAGAGGGAGGTGGG - Intergenic
1076638042 10:131895579-131895601 CTGACTAGGCTGAGGCTCGCAGG + Intergenic
1077435625 11:2537601-2537623 CTGACCTGGCAGAGGGTGCCTGG - Intronic
1077466374 11:2735543-2735565 GTGAGGAGGGAGAGGGTGGTGGG - Intronic
1078004051 11:7519092-7519114 CTGACTGGGAAGATGGTGGCTGG + Intronic
1078731587 11:13979874-13979896 CTCTCTAGGGTGAGGGTGGGTGG - Intronic
1078936586 11:15956783-15956805 CTGGTTGGGGAGAGGGTGGTGGG - Intergenic
1078987793 11:16612021-16612043 CAGGCTAGGGAGTGCGTGGCTGG + Intronic
1079100353 11:17537769-17537791 GTCAGTAGGGAGAGGCTGGCTGG - Intronic
1079364859 11:19800228-19800250 CTGTATAGGGAGAGTGGGGCTGG + Intronic
1079971408 11:27040389-27040411 CTGCCTAGGAAGAGGGTGTTAGG + Intergenic
1080158529 11:29143215-29143237 CTGACTCGGGGGAGGGGGGAGGG - Intergenic
1081779969 11:45703438-45703460 CTGGGTAGGGAGAGGATGCCTGG + Intergenic
1084020208 11:66412813-66412835 CTGAGGCAGGAGAGGGTGGCGGG - Intergenic
1084389118 11:68863488-68863510 CTGCCTGGGGAGGGGGTGGCAGG - Intergenic
1084576686 11:69993136-69993158 CTGTCTCAGGAGGGGGTGGCTGG - Intergenic
1084849766 11:71929240-71929262 CTGACTAGGGGGCGGGTGCGTGG + Intronic
1086345333 11:85890383-85890405 CTGACTAGGGTGTTGGGGGCCGG + Intronic
1087242743 11:95797827-95797849 CTGACTGGGCAGAGGGTGGTCGG + Intronic
1087277137 11:96171849-96171871 CTGAGAATGGAGAAGGTGGCAGG - Intronic
1088871835 11:113896980-113897002 CTGAGTGGGGAGAGGGTGAACGG - Intergenic
1089748488 11:120633713-120633735 CTGAGCAGGGAGAGGCTGGGAGG + Intronic
1090717769 11:129445252-129445274 CTGACGAGGAAGAAGGTGGGTGG - Intronic
1091648157 12:2289336-2289358 CTGCCTGGGGAGGGGGTGGATGG + Intronic
1091744399 12:2982051-2982073 CGGACTAGGGAGAGGACGTCAGG + Intronic
1092052556 12:5482490-5482512 CTGGCTTTGGAGATGGTGGCAGG + Intronic
1093456647 12:19371458-19371480 CTCAGAAGGGAGAGGGTGGAAGG - Intronic
1093516329 12:19990808-19990830 CTTAAGAGGGAGAGGGAGGCAGG + Intergenic
1096121905 12:49093968-49093990 CTGACTAGTGAGAGTGAAGCTGG - Intronic
1097694425 12:62762874-62762896 CCGAGAAGGGAGAGGCTGGCAGG + Intronic
1098247183 12:68532131-68532153 CAGATTGGGGAGAGGGAGGCAGG + Intergenic
1099002854 12:77201321-77201343 GTGGCTAGGGAGAAGGAGGCAGG + Intergenic
1100471370 12:94896328-94896350 CAGAATAGGGAAGGGGTGGCAGG + Intergenic
1100718464 12:97330104-97330126 GTAACTAGGCAGAGGGTGGGTGG + Intergenic
1101854029 12:108427330-108427352 CTCACTAGGTAGAGGGTCCCAGG + Intergenic
1102486418 12:113260753-113260775 CTGAGAAGAGGGAGGGTGGCAGG - Intronic
1102622773 12:114209953-114209975 TTGGCTTGGGAGAGGGGGGCTGG + Intergenic
1102906851 12:116683157-116683179 CTGACTCGGGGGTGGGGGGCGGG - Intergenic
1103905686 12:124326266-124326288 CTGAGGAGACAGAGGGTGGCCGG + Exonic
1104845748 12:131845959-131845981 CCGACCAGGGAGAGGCAGGCCGG - Intronic
1104898280 12:132174802-132174824 CTCACTAGGAAGTGGGTGTCTGG + Intergenic
1105069429 12:133225760-133225782 CAGAAGAGGGGGAGGGTGGCAGG + Intronic
1105332360 13:19429691-19429713 CAGAGTCGGGAGGGGGTGGCAGG + Intronic
1105818114 13:24055415-24055437 CTGCCTAGGGAGATGGAGGATGG + Intronic
1105920514 13:24958955-24958977 CAGAGTGGGGAGGGGGTGGCAGG + Intergenic
1106020448 13:25909796-25909818 CTGAGTTGGGGGAGGGCGGCGGG - Intronic
1107406360 13:40117736-40117758 CTGCCTGGGGAGAGGGAGGCAGG + Intergenic
1110789763 13:79574935-79574957 CTGACTAGGGAGCACATGGCAGG - Intergenic
1113429730 13:110239698-110239720 CTGAATATGCAGAAGGTGGCAGG + Intronic
1114321526 14:21550666-21550688 GTGACTATGAACAGGGTGGCTGG + Intergenic
1114670319 14:24407694-24407716 AGGACCAGGGAGAGAGTGGCTGG + Intronic
1115307228 14:31945328-31945350 CTGACCAGGGAGGTGGTGTCAGG - Intronic
1115447287 14:33505856-33505878 CAGACAAGGGAGAGGGTGGTGGG - Intronic
1118825029 14:69372175-69372197 TTGTCTAGGCAGAAGGTGGCTGG + Intergenic
1119001475 14:70885856-70885878 CCGACAAGGGAGAGGGTCGGGGG + Intergenic
1120881606 14:89418229-89418251 CTGGCTCAGGAGGGGGTGGCAGG - Intronic
1121496412 14:94394612-94394634 CTGAGGAGGGAGAGGTTAGCAGG + Intergenic
1121507395 14:94487178-94487200 CTGTCTAGGGAGGTGGTGACAGG + Intergenic
1121910643 14:97789358-97789380 CTGACTAGGTACAGTGTGGCAGG - Intergenic
1122890708 14:104730942-104730964 CAGACTAGGCAGAGAGTGGGGGG + Intronic
1125513668 15:40306424-40306446 CTGACTGGGCAGAGGGTCACAGG - Intronic
1125540478 15:40467071-40467093 AAGACTAGGGAAAGGGTGGCAGG - Exonic
1126841434 15:52721179-52721201 CTGATAAGAGAGAGGGAGGCAGG - Intergenic
1127221231 15:56883848-56883870 CTGAATTGGGAGAGGGTGAAAGG - Intronic
1127287781 15:57545983-57546005 TTGCCTGGGGAGATGGTGGCTGG + Intronic
1129669078 15:77597171-77597193 CTGAGCAGGGACAGGGTGGGGGG + Intergenic
1129761333 15:78130906-78130928 CTGCCTAGGGCGAGAGTAGCTGG + Intronic
1130843853 15:87726045-87726067 TTGATTAGGGAGATGGTGGAGGG + Intergenic
1131385942 15:92007501-92007523 CTGAATAGGGATAGTGTGGAAGG + Intronic
1131580025 15:93634259-93634281 CTGACTGGGGAGACGGAAGCTGG - Intergenic
1133730130 16:8571743-8571765 CAGAATAGAGCGAGGGTGGCTGG + Intronic
1133791449 16:9012595-9012617 ATAAATAGGGGGAGGGTGGCAGG + Intergenic
1134755091 16:16660102-16660124 ATCATTAGGGAGAGGGTGGTGGG - Intergenic
1134862600 16:17574043-17574065 CTGGCAAGGGAGAGGATGGCCGG + Intergenic
1134990972 16:18699071-18699093 ATCATTAGGGAGAGGGTGGTGGG + Intergenic
1136339603 16:29633433-29633455 CTGAAAAGGCAGTGGGTGGCGGG + Intergenic
1136553260 16:30992969-30992991 CAGACAGGGCAGAGGGTGGCAGG + Intronic
1136609201 16:31356029-31356051 CTGAGCAGGGAGAGGATGGATGG - Intronic
1137684251 16:50374784-50374806 CTGAGGAGGGGGAGGGAGGCAGG + Intergenic
1140501343 16:75436069-75436091 CAGAAGAGGAAGAGGGTGGCAGG - Intronic
1140815151 16:78614445-78614467 CTGGCTGGGGTGAGGGCGGCAGG + Intronic
1141086090 16:81096417-81096439 CTGACTGGGCAGAGCGTGGAGGG + Intergenic
1141685333 16:85566801-85566823 CTGACAAGAGAAAGGGGGGCCGG + Intergenic
1142029146 16:87829780-87829802 CTGCCTCGGGAGTGGGGGGCAGG - Intergenic
1142033151 16:87848408-87848430 TTGCCTAAGGAGAGGGTGGCTGG - Intronic
1142231501 16:88902217-88902239 CTGCCCAGGGAGAGGCCGGCAGG + Intronic
1142434683 16:90048482-90048504 CTCATTAGGGAAAGGGAGGCAGG + Intergenic
1142669164 17:1479578-1479600 CTGACCAGGGTGAGTGGGGCGGG - Exonic
1143370791 17:6437798-6437820 CTGTTTAGGGTGAGGGTGGTGGG - Intergenic
1144453881 17:15403422-15403444 GAGAATAGGGAGAGGGTGGCTGG - Intergenic
1144501328 17:15787997-15788019 CAGAGAAGGGACAGGGTGGCTGG + Intergenic
1145163503 17:20590671-20590693 CAGAGAAGGGACAGGGTGGCTGG + Intergenic
1145783230 17:27577650-27577672 CAGGCAAGGGAGAGGGTGGCAGG - Intronic
1146162655 17:30568352-30568374 CTGACTTGGGAGAGGGATCCAGG - Intergenic
1146291367 17:31609907-31609929 TTGCCTAGGGAGAGTGTGGATGG + Intergenic
1146314809 17:31798422-31798444 CAGCCAAGGGAGAGGGAGGCAGG + Intergenic
1147318385 17:39631917-39631939 CTGGGTAGGGAGAGGCTGGGTGG + Intronic
1147526177 17:41226074-41226096 CTCACTAGGGAAAGGGTGTTTGG - Intronic
1147579657 17:41621125-41621147 CTGACTTGGGAGAGGGATCCAGG - Intronic
1147616387 17:41831020-41831042 CTTAAAAGGAAGAGGGTGGCCGG + Intronic
1149291839 17:55225202-55225224 CTGCCTAGGGAGAGGGAGCCAGG - Intergenic
1149656208 17:58310808-58310830 CTGTCTGGGGAGAGGGGAGCAGG - Intronic
1150621031 17:66807811-66807833 CTGAGAAGGGAGAGGGAGGCGGG + Exonic
1151729206 17:75901073-75901095 CTAACAAGGGAGGGGGTGGCAGG - Intronic
1152235812 17:79137816-79137838 CTGAGAAGGCAGAGTGTGGCTGG - Intronic
1152762191 17:82114605-82114627 GTGACTAGGTGGAGGGCGGCTGG + Intronic
1155986775 18:32238456-32238478 TTGACTAGGGAGAGAGGAGCTGG + Intronic
1157804081 18:50645059-50645081 CAGGCCAGGGAGTGGGTGGCTGG + Intronic
1160261193 18:77295763-77295785 CAGGCAAGGGAGAAGGTGGCTGG + Intergenic
1160434300 18:78833613-78833635 CCGGCTGGGGAGAGGGTGCCGGG - Intergenic
1160821140 19:1058755-1058777 AGGTCTATGGAGAGGGTGGCAGG + Intronic
1160952269 19:1673504-1673526 CAGACCAGGGAGAGGCTGACTGG - Intergenic
1160982783 19:1823851-1823873 CAGGCTTGGGAGAGGGTGGCTGG + Intronic
1161397688 19:4053075-4053097 CTGCTTTGGGAGAGGGTGACAGG - Intronic
1161781532 19:6296333-6296355 CCTACTCGGGAGAGGGAGGCAGG - Intergenic
1162312216 19:9914086-9914108 CCGCCTAGGGGGAGGGGGGCCGG - Intronic
1163664595 19:18597394-18597416 GTGAGTGGGGAGGGGGTGGCAGG - Intronic
1163671178 19:18629583-18629605 CTGAGGAGGGAGAGTGTGCCAGG - Intergenic
1164236939 19:23345758-23345780 CTGACTGGGAAGATGGTGGCTGG - Intronic
1164774998 19:30845967-30845989 CTGACTGGGTAGGGGGTGGATGG + Intergenic
1165152950 19:33771699-33771721 CTGGCCTGGGAGAGGGTGGCGGG - Intronic
1165446135 19:35857525-35857547 CTGGCTAGGGGGAGAGTTGCTGG + Intronic
1165893243 19:39127150-39127172 CTGACTGGGGAGAGTGTCCCTGG + Intronic
1166097315 19:40549061-40549083 CTGAACAAGGAGAGGGTGGAAGG + Intronic
1166470165 19:43072913-43072935 CTGATTAGGGAGAGACTGGGAGG - Intronic
1166938588 19:46349820-46349842 CTGCCTGGAGAGAGGGTGGACGG + Intronic
1167151655 19:47713620-47713642 CAGACTGGGGACAGGGTGGCAGG - Intronic
1167295500 19:48646699-48646721 CTGGCGAGGGAGAGAGGGGCGGG + Intergenic
1167586892 19:50380447-50380469 CTGCCTAGGAAAAGGGTGGGAGG + Intronic
1167946497 19:52992941-52992963 CCGACGAGGGTGAGGGTGGGAGG + Intergenic
925174227 2:1770977-1770999 CTGCTTAGGGGGAGGGTGCCAGG + Intergenic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
925885233 2:8389820-8389842 CTGGCAAAGGAGAGGATGGCTGG + Intergenic
925889988 2:8425887-8425909 CTGCCTAGGGACATGATGGCAGG + Intergenic
925942195 2:8831321-8831343 GTGACTATGTAGAGGGTGGGAGG - Intronic
927419637 2:22916716-22916738 CTGGCAAGGCAGAGGGTAGCAGG + Intergenic
927576876 2:24207818-24207840 CTGCAAAGGGAGAGGGTGGATGG + Intronic
929533206 2:42764905-42764927 CGGAATAGGGAGTGGGAGGCTGG + Intergenic
929960661 2:46493935-46493957 ATGAGGCGGGAGAGGGTGGCGGG + Intronic
930027972 2:47041078-47041100 CTGACTGGGGTGGGGGTGGAGGG - Intronic
930946144 2:57078371-57078393 CTGTGTAAGGAGAGGGGGGCGGG - Intergenic
932865484 2:75336960-75336982 CTGAGGAGGGAGATGGAGGCTGG - Intergenic
935496221 2:103784480-103784502 CTGACTAGGAGGTGGGAGGCGGG + Intergenic
936873911 2:117165474-117165496 ATGACTAGTGGGTGGGTGGCAGG + Intergenic
937098110 2:119248711-119248733 CTGAACAAGGAGGGGGTGGCAGG + Intronic
937859887 2:126699265-126699287 CTGACTAGGGATGGGGATGCTGG - Intergenic
938069360 2:128300349-128300371 CTGGTTTGGGAGAGGGTGGGTGG - Intronic
941911817 2:170771210-170771232 CGGGCTAGGGAGAGGGAGACCGG - Intergenic
942238848 2:173940258-173940280 CTGACAAGGGAGATGGTTTCAGG + Intronic
944748258 2:202680269-202680291 CTGACAAGGGAGAGGGGGGAGGG + Intronic
945048556 2:205802335-205802357 TTGACTCCAGAGAGGGTGGCAGG + Intergenic
945132795 2:206592248-206592270 CTGGCTAGGGAGTGGCTGGGAGG - Intronic
946222665 2:218241849-218241871 CTGAATTTGGAAAGGGTGGCAGG - Intronic
946311010 2:218882628-218882650 CTGTGTAGGCTGAGGGTGGCAGG + Intronic
946401262 2:219469483-219469505 CTGACCAGGGACAGGGTGCCTGG + Intronic
947832837 2:233153894-233153916 CTGCCTAGGGAGGGTGGGGCTGG - Intronic
948076092 2:235166332-235166354 CTGTCCAGGGAGAGGGTGCAGGG - Intergenic
948763983 2:240210250-240210272 CTGAGTAGGGGCGGGGTGGCGGG - Intergenic
948764937 2:240214782-240214804 CTCACTAGGCAGAGAGAGGCTGG + Intergenic
948914158 2:241022550-241022572 CTGAGTAGTGAGAGGTAGGCTGG - Intronic
1169285136 20:4301517-4301539 CTGATTAGGGACAGGGAAGCTGG - Intergenic
1171488422 20:25500060-25500082 GGGAATAGGGAGAGGGGGGCAGG + Intronic
1172149446 20:32779921-32779943 CTGAGCAGGGAGAGGGGGCCAGG + Intronic
1172199308 20:33114041-33114063 AGGACTAGGGAGAGGTGGGCTGG - Intergenic
1172486407 20:35300601-35300623 CTGACCTGGGGGAGGGAGGCAGG + Intergenic
1172589246 20:36105891-36105913 CAGAATAGGGAAAAGGTGGCAGG - Intronic
1172649794 20:36494753-36494775 GTCACTAGGGAGAGGGTGAAGGG - Intronic
1172760372 20:37317199-37317221 CTGACCAGTGAGAGGGTTCCTGG + Exonic
1172835307 20:37869561-37869583 CTGTCTAGGGAGAGAGGGGCTGG + Intronic
1173252615 20:41372566-41372588 CTGACCAGGGAAAGGGAGTCTGG - Intergenic
1173328426 20:42054261-42054283 CTCACTGGGGTGAGGGTGGAGGG + Intergenic
1174184998 20:48700065-48700087 CTGAGTAGGTAGATGGAGGCAGG - Intronic
1175057205 20:56209108-56209130 CTGGCTAGGCAGAAGGTGGAGGG - Intergenic
1175823580 20:61924675-61924697 CTGACATGGGAGTGGGTGGAGGG - Intronic
1175912706 20:62412445-62412467 CAGAGGAGGGCGAGGGTGGCCGG - Intronic
1176111327 20:63412081-63412103 TTGACTCGGGAGCGGGTGGCGGG + Intronic
1176141854 20:63548376-63548398 CTGTCCAGGGAGAGGGTGGGAGG - Intronic
1178192603 21:30302228-30302250 CTGAATAGAAAGAGGGTTGCAGG - Intergenic
1178265752 21:31141609-31141631 CTGAGCAGAGAGTGGGTGGCAGG + Intronic
1178383886 21:32134141-32134163 AGCACTAGGGAGAAGGTGGCAGG + Intergenic
1178413838 21:32387836-32387858 CTGACTAGGGTGATGGCAGCTGG - Intronic
1178488284 21:33032462-33032484 CTGACTAGGGAGAGGGACGTGGG + Intergenic
1179302516 21:40125055-40125077 ATGACTAGGGTGAGGGAGGGTGG - Intronic
1179643694 21:42762656-42762678 CTGACTGGGCTGTGGGTGGCAGG - Intronic
1180880230 22:19198276-19198298 CTGACTAGGGTGGTGGTGACAGG - Intronic
1181539413 22:23565512-23565534 CTGGGAAAGGAGAGGGTGGCAGG + Intergenic
1183524371 22:38314928-38314950 CTGACCAGGAACAGGGTGTCCGG - Intronic
1183985723 22:41569106-41569128 CTCCCTAGAGAGAGGGAGGCAGG + Intronic
1184654094 22:45932478-45932500 CTCACCAGGGAGAGGGTGTCCGG - Intronic
949160763 3:879163-879185 ATGACTCTGGAGAGGGTGGTTGG + Intergenic
949509910 3:4758719-4758741 CTGGCTAGGCAGAGCGTGCCTGG + Intronic
950184178 3:10934928-10934950 CAGACTAGCCAGAGGCTGGCAGG - Intronic
950791199 3:15473824-15473846 CACCCTGGGGAGAGGGTGGCAGG - Intronic
952484217 3:33793278-33793300 CAGAATAAGGAGAGGGTGGAGGG - Intergenic
952901076 3:38112089-38112111 CTGACCAAGGAGAGGCTGGAGGG + Intronic
954134125 3:48574356-48574378 CTGTCTAGGGGGATGGTGGGTGG - Intronic
954287575 3:49629796-49629818 CTGACTAGAGCAAGGGTGGTGGG - Intronic
954318179 3:49812596-49812618 CTGACCAAGGAGAGGCTGCCAGG - Intronic
954574606 3:51668959-51668981 CTGACTAGACAGTGAGTGGCTGG + Intronic
954608936 3:51934126-51934148 GTGACCTGGGGGAGGGTGGCAGG - Intronic
954872945 3:53781419-53781441 CTGACTGGGGAGAGCCTGGTGGG + Intronic
956887108 3:73571297-73571319 CTGAATAGCGGGAGTGTGGCAGG - Intronic
963607040 3:147420778-147420800 ATGACTAGGAAGAAAGTGGCCGG + Intronic
966007614 3:175035450-175035472 GTGACAAGGGACAGGGTGTCTGG + Intronic
967082849 3:186066027-186066049 CTGAGGAGGGAAGGGGTGGCAGG + Exonic
967258905 3:187622414-187622436 CTGTCTAGGGAGATGGAGGATGG - Intergenic
967429371 3:189363901-189363923 CTTACTTGGGAGAGGTTGGGGGG - Intergenic
967690278 3:192465706-192465728 CTGACTTGGGAGTGGGGGTCGGG - Intronic
968075884 3:195815992-195816014 CTGCGTAGGGAGAAGGAGGCCGG - Intergenic
968547377 4:1205997-1206019 CTGACCAGGGAGTGGGGGGTTGG + Intronic
968844368 4:3031762-3031784 GTGACCAGGGAGAGAGTGGCTGG + Intronic
969690344 4:8700828-8700850 CCCACCAGGGAGGGGGTGGCTGG - Intergenic
970321237 4:14877533-14877555 CTGACATGGGAGAGCATGGCAGG - Intergenic
972436017 4:39036172-39036194 CTGAGTATGGAGAGGGTCCCCGG + Intergenic
974489880 4:62551062-62551084 CTGAGATGGGAGAGGGTAGCTGG + Intergenic
974958580 4:68673051-68673073 CTGGCTGGGAAGATGGTGGCTGG - Intergenic
976300242 4:83509528-83509550 CTGACTGGGAAGATGGTGGCTGG + Intronic
976899113 4:90152209-90152231 CTGACTAGTAGGAGGGTGGCAGG + Intronic
976948467 4:90799274-90799296 CTGGCAGGGGAGAGGTTGGCTGG + Intronic
978724345 4:111952766-111952788 CAGACTGGGGTGAGGATGGCAGG - Intergenic
978836671 4:113158739-113158761 CTGACTAAGAACAGGGTAGCAGG - Intronic
979339258 4:119501420-119501442 CTGACTAGGGAGGCTGAGGCAGG - Intronic
982042426 4:151409149-151409171 CTCACTAGGGAGAGGCTGGGGGG + Intergenic
982618607 4:157675292-157675314 TTCACTAGGGAGAGGGAGTCTGG + Intergenic
985579427 5:689156-689178 CTGACAAGGCAGAGGGTGCTGGG + Intronic
985594273 5:781215-781237 CTGACAAGGCAGAGGGTGCTGGG + Intergenic
985670954 5:1206505-1206527 CTGGCTAAGGAGACAGTGGCTGG + Intronic
989586007 5:43074329-43074351 CTGACTGGGAAGATGGTGGCTGG + Intronic
991000320 5:61776254-61776276 GTCACTAGGGACAGGGTGGAGGG + Intergenic
992350153 5:75920621-75920643 CTGCATAGGGAGTGGGTGGTGGG + Intergenic
995644885 5:114300061-114300083 CTGACTATGAAGAGGGTAGGAGG - Intergenic
997981849 5:138472591-138472613 CTGAATAGGGGGAAGGTGGAAGG - Intergenic
997989229 5:138530216-138530238 CTGAATAGGGAGAGTGAGGGTGG + Intronic
999547332 5:152644301-152644323 CTGAGAAGGGAAAGGGTGGGAGG + Intergenic
999773470 5:154792813-154792835 AGGACTTGGGAGAAGGTGGCAGG + Intronic
1001224441 5:169931721-169931743 CTCACATGGGAGAAGGTGGCTGG + Intronic
1001705001 5:173735235-173735257 CTGACTCTGGAGAGGGTGAAGGG - Intergenic
1001880730 5:175241853-175241875 GTGACCAGGGATGGGGTGGCAGG + Intergenic
1002056618 5:176601510-176601532 CTGGCTAGGGTGAGGGCTGCTGG + Intronic
1002132415 5:177089703-177089725 CTGAGGTGGGAGAGGGTGGCAGG + Intronic
1004961247 6:20791111-20791133 ATGCCTAGGCAGAGGGTGTCGGG - Intronic
1005247788 6:23908608-23908630 CTGACTTGGGAGTGTGTGGATGG - Intergenic
1006184782 6:32175663-32175685 CCGACTGGGAAGAGGGTTGCTGG - Intronic
1006521879 6:34575535-34575557 CTGAGTAGGGAGAGTGGGGGCGG + Intergenic
1006558578 6:34889572-34889594 CAGACTGGAGAGGGGGTGGCTGG - Exonic
1007115626 6:39341190-39341212 GTGGCTGGGGAGAGGGTGGAAGG - Intronic
1007656633 6:43454956-43454978 CCGACGAGGGAGAGGGGCGCCGG + Intronic
1007720567 6:43882796-43882818 CTGAGTGAGGAGAGGGTGGCAGG - Intergenic
1009052890 6:58299395-58299417 CAGGCTAGGGAAAGGGTGGTAGG + Intergenic
1009238220 6:61151191-61151213 CAGGCTAGGGAAAGGGTGGTGGG - Intergenic
1012135774 6:95554090-95554112 CAGAATAGGGTGAGGGTGGAGGG - Intergenic
1013185868 6:107757423-107757445 CTGAGGATGGAGAGTGTGGCTGG + Intronic
1013290781 6:108717246-108717268 CTGCATAGGAAGAGAGTGGCAGG + Intergenic
1016995859 6:149962187-149962209 CTGACTTCAGGGAGGGTGGCAGG + Intergenic
1017074686 6:150606888-150606910 CAGAGTTGGGAGAGGGTGGGAGG - Intronic
1017669101 6:156752923-156752945 CTGGCAAGGCCGAGGGTGGCAGG + Intergenic
1018762715 6:166905527-166905549 CTGAAGAGGGATAGGGGGGCTGG + Intronic
1019740014 7:2668086-2668108 CTGGCTAGGGGGAGGGGGGTAGG + Intergenic
1019743815 7:2688570-2688592 CTGGCCTGGGAGAGGATGGCGGG - Intronic
1020340216 7:7101893-7101915 CTGAGTAGGCAGAGGGAGGTTGG - Intergenic
1022003147 7:26244892-26244914 CTGACTGGGAAGATGGCGGCTGG - Intergenic
1022627259 7:32050717-32050739 GTGACTATGGAGAGGGTGAGTGG - Intronic
1023991244 7:45130084-45130106 CTGGCCAGGCAGAGGGTGGCTGG - Intergenic
1024511759 7:50210022-50210044 CTCAGTAGGGAGAGGGAGCCAGG - Intergenic
1024974051 7:55096995-55097017 CTTACTAGGGAAAGGGAGCCAGG - Intronic
1025115170 7:56251635-56251657 CTGACAGGGAAGAGGCTGGCAGG + Intergenic
1029200712 7:98837384-98837406 CTGTGTGGGGAGAGGGTGGCTGG + Intergenic
1029304620 7:99609844-99609866 CTGACTTGGGAGGGTGAGGCAGG - Intergenic
1031325330 7:120389528-120389550 AGGAGTAGGGAGAGGATGGCAGG - Intronic
1031538310 7:122961703-122961725 CTGACTATGGACAGGGTAACTGG - Intergenic
1032384039 7:131509213-131509235 CTAACCAGGGAGAGGGAGGAGGG + Intronic
1033242552 7:139692353-139692375 CTGGCTACAGAGAGGGTGTCAGG + Intronic
1034417725 7:150974093-150974115 CTGGCGCAGGAGAGGGTGGCAGG + Intronic
1035425250 7:158766911-158766933 CTGACTATGGAAGGGGTGGGTGG - Intronic
1035892623 8:3362205-3362227 CAGAGTAGGGATATGGTGGCTGG - Intronic
1038541183 8:28391448-28391470 CAGGCTAGAGAGATGGTGGCTGG - Intronic
1038611775 8:29065577-29065599 CTGAGAAGGGAGAGGGAGGCCGG - Intergenic
1038828363 8:31032491-31032513 CTGGATAGGGAGAGGCCGGCAGG - Exonic
1038895608 8:31778329-31778351 GTGACCAGAGAGAGGCTGGCTGG - Intronic
1042188135 8:66157195-66157217 CTGCCTAGGGAGAGGAGGGTGGG + Intronic
1042257554 8:66821090-66821112 CAGATTGGGGAGAGGGTGCCGGG + Intronic
1043089177 8:75876038-75876060 CTGGCTGGGGAAAGGGTGTCTGG - Intergenic
1045920407 8:107522270-107522292 CTGTTCAGGGAGAGGGTGGAAGG + Intergenic
1047312369 8:123703351-123703373 CTGCCTAGGGGGATGGTAGCTGG + Intronic
1047970734 8:130082100-130082122 CTGAAGAGGGAGAGGCTGGCAGG + Intronic
1049418983 8:142508541-142508563 CTGCTCAGGGAGAGGGTGGAAGG + Intronic
1049646153 8:143736692-143736714 GTGACTATGGAGAAGGTGACTGG - Intergenic
1051504748 9:17814584-17814606 CTGAAAAGGAAGAGGGAGGCAGG + Intergenic
1052978466 9:34429645-34429667 ATGACTAGGGTTGGGGTGGCAGG + Intronic
1053291474 9:36882312-36882334 CTGAGTGGAGCGAGGGTGGCTGG - Intronic
1055474280 9:76646183-76646205 CTAAGTAGGGAGTGGGTTGCTGG - Intronic
1057392658 9:94652596-94652618 CTGAATATGGAGCGGGGGGCGGG - Intergenic
1058677172 9:107410200-107410222 CAGTCCAGGGAGAGGCTGGCTGG + Intergenic
1059027387 9:110649704-110649726 CTGCCTAGGGAGAGTGTAACGGG - Intergenic
1059142980 9:111871420-111871442 CTAACTAGGGAGAAGGAGTCAGG + Intergenic
1061275555 9:129568018-129568040 CTGGGAAAGGAGAGGGTGGCAGG + Intergenic
1187105623 X:16238534-16238556 CTGACTAGGGAAATGGTGAATGG + Intergenic
1189158756 X:38788290-38788312 CTTACTAGGGAGACTGAGGCAGG + Intergenic
1189436608 X:40998366-40998388 CTGTCCAGAGAGAGGTTGGCAGG - Intergenic
1190817457 X:53940614-53940636 CAGGTAAGGGAGAGGGTGGCAGG - Intronic
1192282779 X:69702462-69702484 CTGATTGGGAAGATGGTGGCTGG + Intronic
1194597339 X:95874665-95874687 CTCAGAAGGGAGAGGGTGGGAGG + Intergenic
1195128308 X:101830253-101830275 CTCCTTAGGGACAGGGTGGCAGG - Intergenic
1195177896 X:102328569-102328591 CTCCTTAGGGATAGGGTGGCAGG + Intergenic
1195180968 X:102358524-102358546 CTCCTTAGGGATAGGGTGGCAGG - Intergenic
1195551253 X:106174233-106174255 CTGAATAGCGAGAATGTGGCAGG + Intronic
1196611421 X:117718978-117719000 GTGATTTGAGAGAGGGTGGCTGG - Intergenic
1197958735 X:131980716-131980738 CAGACTAGTGAGAGTGTGCCTGG - Intergenic
1199839512 X:151630324-151630346 CAGACAAGGGTGAGGGTGACAGG - Intronic
1200107419 X:153723013-153723035 CTGTCTGGGGTGGGGGTGGCAGG - Intronic