ID: 1073064470

View in Genome Browser
Species Human (GRCh38)
Location 10:100750027-100750049
Sequence ATCCCCAAAGGGGTCTGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 4, 3: 12, 4: 201}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073064462_1073064470 2 Left 1073064462 10:100750002-100750024 CCAGCGTGCCAAGCCAGAGAGGG 0: 1
1: 0
2: 0
3: 18
4: 221
Right 1073064470 10:100750027-100750049 ATCCCCAAAGGGGTCTGGAGAGG 0: 1
1: 0
2: 4
3: 12
4: 201
1073064464_1073064470 -6 Left 1073064464 10:100750010-100750032 CCAAGCCAGAGAGGGAGATCCCC 0: 1
1: 1
2: 4
3: 20
4: 204
Right 1073064470 10:100750027-100750049 ATCCCCAAAGGGGTCTGGAGAGG 0: 1
1: 0
2: 4
3: 12
4: 201
1073064460_1073064470 27 Left 1073064460 10:100749977-100749999 CCAGCTGGAGGACGTGGCTAAAA 0: 1
1: 0
2: 1
3: 6
4: 101
Right 1073064470 10:100750027-100750049 ATCCCCAAAGGGGTCTGGAGAGG 0: 1
1: 0
2: 4
3: 12
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073064470 Original CRISPR ATCCCCAAAGGGGTCTGGAG AGG Intronic
900980901 1:6045611-6045633 ACAGCCAAGGGGGTCTGGAGAGG - Intronic
902006807 1:13238740-13238762 AGCCCTCAAGAGGTCTGGAGAGG + Intergenic
903064995 1:20694603-20694625 TTTGCCAAAGGGATCTGGAGAGG - Intronic
903257471 1:22112606-22112628 AGCCCAAAAGGGGTTTGGACTGG + Intergenic
904864717 1:33569394-33569416 ATGGCCAATGGGCTCTGGAGTGG - Exonic
917455431 1:175182025-175182047 ATCCCCATCAGGGGCTGGAGTGG - Intronic
919856737 1:201711337-201711359 GTGCCCAAAAGGCTCTGGAGAGG + Intronic
920686860 1:208116018-208116040 TTGACCAAAGGGGTCAGGAGTGG - Intronic
922351066 1:224734959-224734981 ATCTCCAAAGGGATGTTGAGAGG - Intronic
922983843 1:229850965-229850987 ATCCCCAGTTGGGTCTGGGGCGG - Intergenic
923631269 1:235650332-235650354 ATCACCGGAGGGGTCTGGGGCGG + Intronic
1069724528 10:70568816-70568838 AGGCCCAAAGGGGTCAGGTGGGG - Intergenic
1070762853 10:79035555-79035577 CTCCCCAAATGGGTGTTGAGTGG - Intergenic
1070775389 10:79106774-79106796 ATCGACAAATGGGACTGGAGAGG + Intronic
1073064470 10:100750027-100750049 ATCCCCAAAGGGGTCTGGAGAGG + Intronic
1074112821 10:110434434-110434456 ATCCCCAAAGAGGAATGGGGTGG + Intergenic
1076765619 10:132631359-132631381 AGCCCCGAAGGGACCTGGAGAGG + Intronic
1078729677 11:13963492-13963514 TTCTCCAAATCGGTCTGGAGGGG + Intronic
1084219493 11:67668373-67668395 AACCCCAGTGGGGTCTGGAGAGG + Intronic
1084399491 11:68935432-68935454 GTCCCCAAAGGACTCTGGCGAGG - Intronic
1084698228 11:70768946-70768968 TTCCCCAAAGGTGTCTGCACAGG + Intronic
1084961941 11:72721436-72721458 ATCCCCAGAGGGGTGTAGGGAGG + Intronic
1087080847 11:94169679-94169701 ATGCCCACAGGGGGCTGGATTGG + Intronic
1089160039 11:116430258-116430280 ATTACCAAAGGGAACTGGAGGGG - Intergenic
1091239427 11:134042653-134042675 ATCCCCAAATGTGTGTGGAGTGG - Intergenic
1091413629 12:261152-261174 ATCCCAACAGTGGTCTGGAATGG - Intronic
1091726243 12:2848504-2848526 ATCCCCAACAGGGTGTGGAGAGG + Intronic
1092247870 12:6873386-6873408 AGCCCCAGAGGGCCCTGGAGGGG - Intronic
1092929041 12:13298003-13298025 ATCCCCAAAGGGGGCTTGAGAGG + Intergenic
1096594711 12:52687485-52687507 CTCCCCAAAGACTTCTGGAGGGG - Intergenic
1102164792 12:110797587-110797609 ATACCCAGTGGGGCCTGGAGGGG + Intergenic
1102173473 12:110859727-110859749 ATCCACAAAGGGGTCCGGGAAGG + Intronic
1110969127 13:81739460-81739482 ATCCCCACAGGGGTCTGGATGGG - Intergenic
1111653425 13:91122658-91122680 AACCCCAGTGGGGTCTAGAGTGG + Intergenic
1113532173 13:111036065-111036087 ATTGCCAAAGGTGTCCGGAGGGG + Intergenic
1114493514 14:23117809-23117831 GTGGCCAAAGGGGCCTGGAGGGG + Exonic
1117498080 14:56325844-56325866 ATCCCCAACAGAGACTGGAGTGG - Intergenic
1118616462 14:67577494-67577516 ACCCACAGAGGGATCTGGAGAGG + Intronic
1118818479 14:69329065-69329087 ATTGGCAAAGGGGCCTGGAGCGG + Intronic
1118820905 14:69345301-69345323 CTCCCAAAGGGAGTCTGGAGAGG + Intronic
1121049344 14:90810221-90810243 ATTCCCAATGGGGTCTGGGGCGG - Intronic
1123119222 14:105909180-105909202 AGGCCCAGTGGGGTCTGGAGAGG + Intergenic
1202894311 14_KI270722v1_random:189534-189556 ATCCCAAAAGGGGCGGGGAGGGG - Intergenic
1125598777 15:40904115-40904137 ATCCCCAATGAGCCCTGGAGAGG - Intergenic
1128870703 15:71153212-71153234 TTCCCCATAGGGGAGTGGAGGGG + Intronic
1132322378 15:100935468-100935490 AGCACCAAATGGGGCTGGAGAGG + Intronic
1132640756 16:977327-977349 CTCCCGAAGGGGGTCTTGAGAGG + Intronic
1132994986 16:2818134-2818156 AGACCCAAAGGGAACTGGAGTGG - Intronic
1133584660 16:7181334-7181356 AGAACCAAAGGGGTTTGGAGAGG - Intronic
1136048145 16:27631674-27631696 ACCCCCAAGTGGGGCTGGAGTGG - Intronic
1141142186 16:81503810-81503832 ATCCGCTCAGGGATCTGGAGGGG - Intronic
1141643231 16:85353829-85353851 ATCCCCGCAGGGGCCAGGAGGGG - Intergenic
1141882479 16:86869211-86869233 ATCCCCCCAGGGGTCAGGACCGG - Intergenic
1142245577 16:88968700-88968722 ATTCCCAAGGGGGCCTGCAGTGG - Intronic
1142883904 17:2901075-2901097 ATGGTCAAAGGGGCCTGGAGTGG - Intronic
1143991648 17:10968559-10968581 TTCCCCTTAGGGGACTGGAGTGG - Intergenic
1144209177 17:13000322-13000344 ATCCCCAATGGGGTCTGCTGAGG - Intronic
1146558886 17:33851085-33851107 ATCCCCAAAGGGGTCAGGTAGGG + Intronic
1146964378 17:37012341-37012363 ATCCCCAAAAGGGCCGGGTGTGG - Intronic
1147895474 17:43748278-43748300 TTCCCCAAGGGGGTTTGCAGTGG + Intergenic
1149557944 17:57587566-57587588 AGCCCCAAAGGTGGCTGCAGAGG + Intronic
1151544698 17:74785622-74785644 TTCCCCACAGGGGCCAGGAGTGG + Intronic
1151863513 17:76783852-76783874 ACTCCCAAGGGGGTCAGGAGTGG - Intergenic
1152031741 17:77847169-77847191 ATCCCCAAAGAAGCCTTGAGAGG + Intergenic
1152431678 17:80251799-80251821 ATCACCAAAGTGGACTGGGGTGG - Intronic
1152528695 17:80904208-80904230 AGCCCCTGAGGGGTCAGGAGGGG + Intronic
1157177464 18:45464771-45464793 ATCCTCCAAGGGGGCTGGTGTGG + Intronic
1158980350 18:62754622-62754644 TTTCCCTCAGGGGTCTGGAGAGG - Intronic
1159367242 18:67484161-67484183 ATCCCTAAAGTGGTCAGCAGCGG - Intergenic
1160074086 18:75655433-75655455 ATCTCCCAAGAGGCCTGGAGTGG + Intergenic
1164278568 19:23747347-23747369 ATCCCCAAAGTGGCCGGGCGCGG + Intronic
1164752329 19:30666014-30666036 AGCCCCAAAGGGCTCTGAGGAGG + Intronic
1165511781 19:36270400-36270422 ATCCAGAAAGAGGTGTGGAGAGG - Intergenic
1165512331 19:36272901-36272923 ATCCAGAAAGAGGTGTGGAGAGG - Intergenic
1165512878 19:36275442-36275464 ATCCAGAAAGAGGTGTGGAGAGG - Intergenic
1165513434 19:36277997-36278019 ATCCAGAAAGAGGTGTGGAGAGG - Intergenic
1165513984 19:36280531-36280553 ATCCAGAAAGAGGTGTGGAGAGG - Intergenic
1165514536 19:36283068-36283090 ATCCAGAAAGAGGTGTGGAGAGG - Intergenic
1165515088 19:36285601-36285623 ATCCAGAAAGAGGTGTGGAGAGG - Intergenic
1165515638 19:36288137-36288159 ATCCAGAAAGAGGTGTGGAGAGG - Intergenic
1165516190 19:36290674-36290696 ATCCAGAAAGAGGTGTGGAGAGG - Intergenic
1165516740 19:36293200-36293222 ATCCAGAAAGAGGTGTGGAGAGG - Intergenic
1165517293 19:36295723-36295745 ATCCAGAAAGAGGTGTGGAGAGG - Intergenic
1165517845 19:36298258-36298280 ATCCAGAAAGAGGTGTGGAGAGG - Intergenic
1165518397 19:36300793-36300815 ATCCAGAAAGAGGTGTGGAGAGG - Intergenic
1165518946 19:36303325-36303347 ATCCAGAAAGAGGTGTGGAGAGG - Intergenic
1165519496 19:36305840-36305862 ATCCAGAAAGAGGTGTGGAGAGG - Intergenic
1165520045 19:36308368-36308390 ATCCAGAAAGAGGTGTGGAGAGG - Intergenic
1165624023 19:37270213-37270235 ATCCAGAAAGAGGTGTGGAGAGG + Intergenic
1165624569 19:37272754-37272776 ATCCAGAAAGAGGTGTGGAGAGG + Intergenic
1165625112 19:37275281-37275303 ATCCAGAAAGAGGTGTGGAGAGG + Intergenic
1165625646 19:37277819-37277841 ATCCAGAAAGAGGTGTGGAGAGG + Intergenic
1165626186 19:37280344-37280366 ATCCAGAAAGAGGTGTGGAGAGG + Intergenic
1165626727 19:37282871-37282893 ATCCAGAAAGAGGTGTGGAGAGG + Intergenic
1165627267 19:37285392-37285414 ATCCAGAAAGAGGTGTGGAGAGG + Intergenic
1165627808 19:37287920-37287942 ATCCAGAAAGAGGTGTGGAGAGG + Intergenic
1165628346 19:37290444-37290466 ATCCAGAAAGAGGTGTGGAGAGG + Intergenic
1165628885 19:37292969-37292991 ATCCAGAAAGAGGTGTGGAGAGG + Intergenic
1165629428 19:37295495-37295517 ATCCAGAAAGAGGTGTGGAGAGG + Intergenic
1165629969 19:37298020-37298042 ATCCAGAAAGAGGTGTGGAGAGG + Intergenic
1165630512 19:37300548-37300570 ATCCAGAAAGAGGTGTGGAGAGG + Intergenic
1165631048 19:37303086-37303108 ATCCAGAAAGAGGTGTGGAGAGG + Intergenic
1165743754 19:38218437-38218459 ATCCCCAGAGCGGCCTGCAGGGG - Intronic
1165779297 19:38422956-38422978 ATTCCCTGAGGGGTCTTGAGTGG - Intronic
1166976752 19:46609427-46609449 CTCCCCAAGGGGATCTGGGGAGG - Exonic
926310113 2:11669125-11669147 CTCCCCAGACGGCTCTGGAGAGG - Intronic
927087082 2:19682911-19682933 TTCTCCAAAGGGGTATGGAATGG - Intergenic
927494933 2:23545909-23545931 CTCAACAAAGGGGTCTGCAGAGG - Intronic
927962899 2:27251620-27251642 AGCTTCAAAGGGGCCTGGAGTGG + Intergenic
928084758 2:28339106-28339128 GTCCACACAGGGGGCTGGAGGGG - Intergenic
929611230 2:43272185-43272207 AACCCCAAAGATGGCTGGAGTGG + Intronic
934776477 2:96940971-96940993 CTCCCCACTGGTGTCTGGAGAGG - Intronic
937297367 2:120817794-120817816 GCCCGCAAAGGAGTCTGGAGCGG - Intronic
939496658 2:142934385-142934407 AGCCCCAGAGGGGTCTGGGTTGG + Intronic
944210484 2:197201827-197201849 ATCCCAAAAGGGGGCAGGATGGG - Intronic
946147656 2:217743150-217743172 GGCCCCAAAAGGGGCTGGAGGGG + Intronic
1170536667 20:17347342-17347364 ATCCAAACAGGGATCTGGAGAGG - Intronic
1171142012 20:22751447-22751469 ATGCCCAGAGGAGTTTGGAGGGG - Intergenic
1173648574 20:44649028-44649050 ATCCCCAAAGGCTTCTGCAGAGG + Intronic
1174095649 20:48087652-48087674 ATCTCCAAAGGGATGTGGTGAGG - Intergenic
1174361660 20:50032673-50032695 ATCCCCAAATGGGCCTGGCATGG + Intergenic
1174390674 20:50216664-50216686 ATCCCCAGGGAGGCCTGGAGGGG - Intergenic
1175812182 20:61864338-61864360 CTCCCCAAAGGGGACTGCACTGG - Intronic
1175826877 20:61941244-61941266 GTGCCCAGAGGTGTCTGGAGGGG + Intergenic
1180169568 21:46050812-46050834 AGCTCCCAAGGGGTCTGGTGTGG + Intergenic
1180796521 22:18608473-18608495 TCCCCAGAAGGGGTCTGGAGAGG + Exonic
1181225202 22:21386798-21386820 TCCCCAGAAGGGGTCTGGAGAGG - Exonic
1181253430 22:21548015-21548037 TCCCCAGAAGGGGTCTGGAGAGG + Exonic
1182856091 22:33518771-33518793 ACCCCCTGAGGGGACTGGAGTGG + Intronic
1184872625 22:47250687-47250709 TTCCCCACTGGGTTCTGGAGGGG + Intergenic
1185087593 22:48749175-48749197 AACCCCTAGGGGGCCTGGAGTGG + Intronic
950395262 3:12729135-12729157 ATGCCCAAAGGGGACTTGAAGGG - Intergenic
950395517 3:12731076-12731098 ATGCCCAAAGGGGACTTGAAGGG - Intergenic
950582685 3:13872781-13872803 GTCCCCACAGAGGTCTGGGGTGG - Intronic
950796517 3:15514747-15514769 ATGCCCAGAGGGGGCTAGAGAGG + Intronic
952120267 3:30233692-30233714 ACCCCCAAAGGGGTTGGGAGTGG - Intergenic
952352654 3:32555256-32555278 ATCCCCTGAGGGGTCTTAAGAGG - Intronic
954090391 3:48279410-48279432 AGCCACAGAGGGCTCTGGAGGGG + Intronic
954580082 3:51698550-51698572 ATCCCCCAATGAGTATGGAGGGG - Intronic
955101560 3:55854782-55854804 ATTCACAATGGGCTCTGGAGTGG + Intronic
956962103 3:74415193-74415215 ATCCCCTAACTGGTCTGCAGTGG - Intronic
960519480 3:118638575-118638597 AGCTCCACAGGGCTCTGGAGAGG - Intergenic
961849769 3:129804442-129804464 ATAGCCAAAGGGGTCAGGGGAGG - Intronic
963072552 3:141316696-141316718 ATTCCTAAAGGGGTCTAAAGTGG - Intergenic
963837845 3:150074907-150074929 ATCTCCAAAGCAGTCGGGAGTGG - Intergenic
966859026 3:184218252-184218274 ATCCCCAGTGGGGTCTGGAATGG + Intronic
967119924 3:186373757-186373779 GTCCCCAAAGTGGTCTGCAATGG - Intergenic
968523142 4:1043509-1043531 GTGCCCTAAGGGGTCAGGAGGGG + Intergenic
969590508 4:8119265-8119287 AAGCCCAAAGGAGGCTGGAGAGG + Intronic
969610401 4:8224857-8224879 ATCCCCACAGGGGTTGGGTGGGG + Intronic
970615882 4:17767715-17767737 AGACCCAAAGGGGGCTGGCGGGG - Intronic
971173938 4:24262606-24262628 ATAGCCAAAGGGGTCTGGAAAGG - Intergenic
975346105 4:73294107-73294129 CTCCACAAAGGGGTATGAAGTGG - Intergenic
980354293 4:131723839-131723861 ATCCAGAAAGAGGTGTGGAGAGG - Intergenic
980354830 4:131726345-131726367 ATCCAGAAAGAGGTGTGGAGAGG - Intergenic
980355367 4:131728822-131728844 ATCCAGAAAGAGGTGTGGAGAGG - Intergenic
980355916 4:131731323-131731345 ATCCAGAAAGAGGTGTGGAGAGG - Intergenic
980356449 4:131733811-131733833 ATCCAGAAAGAGGTGTGGAGAGG - Intergenic
980357530 4:131738794-131738816 ATCCAGAAAGTGGTGTGGAGAGG - Intergenic
980358600 4:131743774-131743796 ATCCAGAAAGAGGTGTGGAGAGG - Intergenic
980360221 4:131751210-131751232 ATCCAGAAAGAGGTGTGGAGAGG - Intergenic
980361307 4:131756165-131756187 ATCCAGAAAGTGGTGTGGAGAGG - Intergenic
980362390 4:131761120-131761142 ATCCAGAAAGTGGTGTGGAGAGG - Intergenic
980362930 4:131763603-131763625 ATCCAGAAAGAGGTGTGGAGAGG - Intergenic
980378352 4:131977389-131977411 ATCCAGAAAGAGGTGTGGAGAGG + Intergenic
982427974 4:155288350-155288372 ATCCACAAACAGCTCTGGAGAGG - Intergenic
983343218 4:166493153-166493175 ACTCCTAAAGGGGTCTGCAGAGG - Intergenic
984953273 4:185021595-185021617 ATCCCCTAAGGGGTGGGGAAGGG - Intergenic
985960538 5:3299688-3299710 CTCCCCACAGCCGTCTGGAGAGG - Intergenic
988331715 5:29850130-29850152 AGCCAGAAAGGGGTATGGAGTGG + Intergenic
990824841 5:59887233-59887255 ATCTCCAAAGTGGTATGGTGAGG + Intronic
991564055 5:67986090-67986112 TTGCCCAAGGGGGTCTGGGGAGG + Intergenic
996665415 5:126053865-126053887 ATCCCAAAAGGGGGGTGGTGTGG + Intergenic
1004003754 6:11620635-11620657 ATCCCCAAAGGGATCTGGATCGG - Intergenic
1005012648 6:21350348-21350370 GGCCCCAAAGGGGACAGGAGGGG + Intergenic
1005323979 6:24681744-24681766 ATCTCCAAAGGGATCTAGGGAGG - Intronic
1006058866 6:31404689-31404711 TTCCCCTTGGGGGTCTGGAGGGG - Intronic
1008921792 6:56850351-56850373 TTCCTCCAAGGGGGCTGGAGGGG - Intronic
1009737016 6:67689190-67689212 GTCCACAAAGGGCTCTGAAGTGG - Intergenic
1010477385 6:76305132-76305154 GCCCACAGAGGGGTCTGGAGAGG - Intergenic
1011947037 6:92918445-92918467 ATCACCTAAGCTGTCTGGAGTGG - Intergenic
1015498504 6:133906418-133906440 ATCCCCAAAGGAAACTGGAGTGG + Intergenic
1016361156 6:143268785-143268807 ATCCCCAAAGGGGACCTGTGTGG - Intronic
1018794092 6:167172371-167172393 ATTCCTACAGGGGTCTGGCGAGG - Intronic
1018822243 6:167382705-167382727 ATTCCTACAGGGGTCTGGCGAGG + Intronic
1019342399 7:514725-514747 TTCCCCAAAGTGGTCTGGCCTGG - Intronic
1026538167 7:71257687-71257709 ATCCCCACAGTGGCCTGGAAGGG - Intronic
1029141271 7:98412205-98412227 TTCCCCAAAGGGGACAGCAGGGG + Intergenic
1029288147 7:99480371-99480393 ATCCCCAGTAGGGTTTGGAGTGG - Intronic
1029625654 7:101718785-101718807 ATCCCCAGAGTGTTCCGGAGAGG + Intergenic
1030545970 7:110895481-110895503 ATAGCCAAAGGGGTTTGGAAAGG - Intronic
1034746756 7:153529869-153529891 CTTCCCAAAGGGGCCTGGGGAGG - Intergenic
1035265896 7:157690239-157690261 ATCCCCAAGTGGGTCTAGGGTGG - Intronic
1035866278 8:3085870-3085892 AAGCACAAAGGGGTCCGGAGAGG - Intronic
1036584047 8:10106759-10106781 ATTCCCAAGGGTGTATGGAGAGG - Intronic
1037700709 8:21271688-21271710 AGCCCCAGAGTGTTCTGGAGGGG + Intergenic
1038928767 8:32170092-32170114 TTCCTCTAAGGGCTCTGGAGGGG - Intronic
1039816803 8:41101398-41101420 ACCCAGAAAGGGGTCTGGAGAGG + Intergenic
1040414777 8:47186534-47186556 AAACCCAAAGGGGGCTGGATTGG + Intergenic
1045317773 8:101058191-101058213 ATCCTTAAAGGAGTTTGGAGAGG + Intergenic
1047597524 8:126393918-126393940 GTCCCCACAGGTCTCTGGAGAGG - Intergenic
1049353710 8:142177533-142177555 ACCCCAAGGGGGGTCTGGAGGGG + Intergenic
1049577805 8:143397760-143397782 CTCCCCAAGGGGCTCTGGCGAGG + Intergenic
1049689710 8:143953193-143953215 AAACCCAAAGGGGTCTGGAGTGG - Intronic
1052081042 9:24205891-24205913 ATGGCCATAGGGGACTGGAGTGG + Intergenic
1054458588 9:65449944-65449966 GTCCTCAAAGGGGGCTGGGGGGG - Intergenic
1054714469 9:68543355-68543377 CTCCTCAAAGGGCACTGGAGGGG - Intergenic
1055011197 9:71567388-71567410 ATACCCAAGGGGGTCAGGGGAGG + Intergenic
1056546994 9:87621290-87621312 ATACCCAAAGGTGTGGGGAGAGG + Intronic
1061010363 9:127950955-127950977 ACCCCCACAGGGGTTGGGAGGGG + Intronic
1203782058 EBV:106127-106149 GTCCCTAAAGGGGACGGGAGAGG + Intergenic
1203491321 Un_GL000224v1:108190-108212 ATCCCAAAAGGGGCAGGGAGGGG - Intergenic
1203503945 Un_KI270741v1:50060-50082 ATCCCAAAAGGGGCAGGGAGGGG - Intergenic
1185689701 X:2144113-2144135 ATCCTCAAAGGGGCCGGGCGTGG - Intergenic
1191104168 X:56762016-56762038 ATCCACAAATAGGTCTGCAGGGG - Intergenic
1191997053 X:67106665-67106687 ACCCCCAAAGGTGTTGGGAGGGG - Intergenic
1192804312 X:74495942-74495964 ATCCCCAAGGTGTTCAGGAGGGG + Intronic
1195794947 X:108635969-108635991 TTCCCAAAAGGGGTAAGGAGTGG + Intronic