ID: 1073065205

View in Genome Browser
Species Human (GRCh38)
Location 10:100754522-100754544
Sequence CTCCTAGCAGTGGCAACCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073065199_1073065205 23 Left 1073065199 10:100754476-100754498 CCACACTCTCTCTTAGCCTGTTA 0: 1
1: 0
2: 3
3: 41
4: 357
Right 1073065205 10:100754522-100754544 CTCCTAGCAGTGGCAACCCAGGG No data
1073065202_1073065205 7 Left 1073065202 10:100754492-100754514 CCTGTTAGGCTCTAGGTGAGTAC 0: 1
1: 0
2: 0
3: 0
4: 48
Right 1073065205 10:100754522-100754544 CTCCTAGCAGTGGCAACCCAGGG No data
1073065198_1073065205 30 Left 1073065198 10:100754469-100754491 CCACTATCCACACTCTCTCTTAG No data
Right 1073065205 10:100754522-100754544 CTCCTAGCAGTGGCAACCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073065205 Original CRISPR CTCCTAGCAGTGGCAACCCA GGG Intronic
No off target data available for this crispr