ID: 1073066446

View in Genome Browser
Species Human (GRCh38)
Location 10:100762252-100762274
Sequence ATTTCTCTCCAGCAGTTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073066442_1073066446 2 Left 1073066442 10:100762227-100762249 CCATCAGGAAGGGTCAAGGGCCT 0: 1
1: 0
2: 2
3: 21
4: 166
Right 1073066446 10:100762252-100762274 ATTTCTCTCCAGCAGTTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073066446 Original CRISPR ATTTCTCTCCAGCAGTTTGA GGG Intronic
No off target data available for this crispr