ID: 1073066452

View in Genome Browser
Species Human (GRCh38)
Location 10:100762284-100762306
Sequence GTCCACACCGGGGTTTCACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073066447_1073066452 1 Left 1073066447 10:100762260-100762282 CCAGCAGTTTGAGGGTCATCTGC 0: 1
1: 0
2: 0
3: 11
4: 132
Right 1073066452 10:100762284-100762306 GTCCACACCGGGGTTTCACTGGG No data
1073066444_1073066452 14 Left 1073066444 10:100762247-100762269 CCTGGATTTCTCTCCAGCAGTTT 0: 1
1: 0
2: 2
3: 17
4: 245
Right 1073066452 10:100762284-100762306 GTCCACACCGGGGTTTCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073066452 Original CRISPR GTCCACACCGGGGTTTCACT GGG Intronic
No off target data available for this crispr