ID: 1073068445

View in Genome Browser
Species Human (GRCh38)
Location 10:100778424-100778446
Sequence CATATCCAGCACTGTGAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073068439_1073068445 -10 Left 1073068439 10:100778411-100778433 CCCTCCCCACCTTCATATCCAGC 0: 1
1: 0
2: 6
3: 42
4: 566
Right 1073068445 10:100778424-100778446 CATATCCAGCACTGTGAGCTAGG No data
1073068433_1073068445 27 Left 1073068433 10:100778374-100778396 CCCTCGGGTAACTGAGCTTTTTT 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1073068445 10:100778424-100778446 CATATCCAGCACTGTGAGCTAGG No data
1073068438_1073068445 -9 Left 1073068438 10:100778410-100778432 CCCCTCCCCACCTTCATATCCAG 0: 1
1: 0
2: 2
3: 52
4: 483
Right 1073068445 10:100778424-100778446 CATATCCAGCACTGTGAGCTAGG No data
1073068434_1073068445 26 Left 1073068434 10:100778375-100778397 CCTCGGGTAACTGAGCTTTTTTG 0: 1
1: 0
2: 0
3: 4
4: 143
Right 1073068445 10:100778424-100778446 CATATCCAGCACTGTGAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073068445 Original CRISPR CATATCCAGCACTGTGAGCT AGG Intronic
No off target data available for this crispr