ID: 1073068501

View in Genome Browser
Species Human (GRCh38)
Location 10:100778727-100778749
Sequence CCTTCTCCCCAGGATGTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073068492_1073068501 14 Left 1073068492 10:100778690-100778712 CCCTGAAAAGCAGGCTCCTGGAA 0: 1
1: 0
2: 0
3: 24
4: 210
Right 1073068501 10:100778727-100778749 CCTTCTCCCCAGGATGTACAGGG No data
1073068489_1073068501 30 Left 1073068489 10:100778674-100778696 CCTCGGTTTTTCAGATCCCTGAA 0: 1
1: 0
2: 0
3: 14
4: 192
Right 1073068501 10:100778727-100778749 CCTTCTCCCCAGGATGTACAGGG No data
1073068493_1073068501 13 Left 1073068493 10:100778691-100778713 CCTGAAAAGCAGGCTCCTGGAAT 0: 1
1: 0
2: 2
3: 9
4: 195
Right 1073068501 10:100778727-100778749 CCTTCTCCCCAGGATGTACAGGG No data
1073068495_1073068501 -2 Left 1073068495 10:100778706-100778728 CCTGGAATGTTTGATTTGGCCCC 0: 1
1: 0
2: 2
3: 12
4: 110
Right 1073068501 10:100778727-100778749 CCTTCTCCCCAGGATGTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073068501 Original CRISPR CCTTCTCCCCAGGATGTACA GGG Intronic
No off target data available for this crispr