ID: 1073068765

View in Genome Browser
Species Human (GRCh38)
Location 10:100780358-100780380
Sequence CTGTAGCCATAGATGAGGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073068756_1073068765 28 Left 1073068756 10:100780307-100780329 CCAACGCACACAGACTAGCTTCC 0: 1
1: 0
2: 0
3: 6
4: 125
Right 1073068765 10:100780358-100780380 CTGTAGCCATAGATGAGGCCCGG No data
1073068755_1073068765 29 Left 1073068755 10:100780306-100780328 CCCAACGCACACAGACTAGCTTC 0: 1
1: 0
2: 0
3: 7
4: 77
Right 1073068765 10:100780358-100780380 CTGTAGCCATAGATGAGGCCCGG No data
1073068760_1073068765 6 Left 1073068760 10:100780329-100780351 CCTCTGGCCCAAGGAGAAACTTG 0: 1
1: 0
2: 1
3: 8
4: 172
Right 1073068765 10:100780358-100780380 CTGTAGCCATAGATGAGGCCCGG No data
1073068759_1073068765 7 Left 1073068759 10:100780328-100780350 CCCTCTGGCCCAAGGAGAAACTT 0: 1
1: 0
2: 0
3: 10
4: 177
Right 1073068765 10:100780358-100780380 CTGTAGCCATAGATGAGGCCCGG No data
1073068762_1073068765 -1 Left 1073068762 10:100780336-100780358 CCCAAGGAGAAACTTGGTGCTAC No data
Right 1073068765 10:100780358-100780380 CTGTAGCCATAGATGAGGCCCGG No data
1073068763_1073068765 -2 Left 1073068763 10:100780337-100780359 CCAAGGAGAAACTTGGTGCTACT 0: 1
1: 0
2: 3
3: 16
4: 177
Right 1073068765 10:100780358-100780380 CTGTAGCCATAGATGAGGCCCGG No data
1073068754_1073068765 30 Left 1073068754 10:100780305-100780327 CCCCAACGCACACAGACTAGCTT 0: 1
1: 0
2: 1
3: 9
4: 86
Right 1073068765 10:100780358-100780380 CTGTAGCCATAGATGAGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073068765 Original CRISPR CTGTAGCCATAGATGAGGCC CGG Intronic
No off target data available for this crispr