ID: 1073068850

View in Genome Browser
Species Human (GRCh38)
Location 10:100780886-100780908
Sequence CCTTCTAGGCAGCACCTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 197}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073068850_1073068854 -1 Left 1073068850 10:100780886-100780908 CCATGGAGGTGCTGCCTAGAAGG 0: 1
1: 0
2: 1
3: 15
4: 197
Right 1073068854 10:100780908-100780930 GAGACAGGTTTGCTGTTTCCTGG No data
1073068850_1073068858 23 Left 1073068850 10:100780886-100780908 CCATGGAGGTGCTGCCTAGAAGG 0: 1
1: 0
2: 1
3: 15
4: 197
Right 1073068858 10:100780932-100780954 CCTGTACTCCATCCGTCTTTAGG No data
1073068850_1073068855 0 Left 1073068850 10:100780886-100780908 CCATGGAGGTGCTGCCTAGAAGG 0: 1
1: 0
2: 1
3: 15
4: 197
Right 1073068855 10:100780909-100780931 AGACAGGTTTGCTGTTTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073068850 Original CRISPR CCTTCTAGGCAGCACCTCCA TGG (reversed) Intronic
900030059 1:364775-364797 CCACCTAGTCAGCAGCTCCAGGG + Intergenic
900050711 1:593839-593861 CCACCTAGTCAGCAGCTCCAGGG + Intergenic
902236811 1:15062941-15062963 CCTTCCAGGCAGGAGCTCCAGGG - Intronic
904463199 1:30692619-30692641 CAGTGTAGGCAGCACCTCCTTGG - Intergenic
905169418 1:36100248-36100270 TCTTCTTTGCAGCACGTCCACGG - Exonic
905268605 1:36771919-36771941 CCTTCTTGGCTGCAGCTCCTTGG + Intergenic
908055526 1:60281964-60281986 CCTTCTAGTCATCACCTCTCTGG - Intergenic
909616039 1:77609117-77609139 TCTTGTAGGCAGCAGATCCATGG - Intronic
909640325 1:77865152-77865174 CCTTCCTGGAATCACCTCCAAGG + Intronic
911986497 1:104632166-104632188 CCCTCTAATCAGCACCACCACGG + Intergenic
917491210 1:175500262-175500284 CCTTCTAGCAAGCAACTCCCTGG - Intronic
917729390 1:177859114-177859136 CCTTCTAGGGATCTACTCCAAGG + Intergenic
919448098 1:197735620-197735642 CCTTCATGGCGGCAGCTCCACGG - Intronic
919925335 1:202189073-202189095 GCCTCTAGGCAGCACCACCCGGG + Intergenic
920496757 1:206460421-206460443 CCTTCCAGCCATCACCACCAAGG - Intronic
920898741 1:210085011-210085033 CATTCTAGGCAGTGCCTGCATGG - Intronic
921373240 1:214447225-214447247 CCTTCCAGGCAGCTCAGCCAAGG - Intronic
923781658 1:237030578-237030600 CTATCTACGCAGCCCCTCCATGG - Intergenic
924604913 1:245525083-245525105 CCTTCTACTCTGCACCTCCCTGG + Intronic
1064227931 10:13503957-13503979 CCTCCTAGGCAGCAGCTGCAGGG - Intronic
1068188705 10:53621068-53621090 CCTTCTAGTCACTACTTCCATGG - Intergenic
1068666663 10:59683641-59683663 CCTTCTAGGCAGCTTCTACATGG - Intronic
1073068850 10:100780886-100780908 CCTTCTAGGCAGCACCTCCATGG - Intronic
1073125873 10:101148819-101148841 CTTTCTAGGCAGGACCATCAAGG - Intergenic
1073287704 10:102398635-102398657 GCTCCTAGGAAGCACCTCCTGGG - Intronic
1073745803 10:106467223-106467245 CCATCTTGGAAGCAACTCCAAGG - Intergenic
1074238089 10:111606602-111606624 TCATTTAGGTAGCACCTCCATGG - Intergenic
1076495378 10:130893714-130893736 CCTGCAAGGCAAAACCTCCACGG + Intergenic
1077010982 11:379230-379252 CCTTCCAGCCACCCCCTCCAGGG - Intronic
1077245817 11:1537508-1537530 CCTCTGAGGCAGCAGCTCCAAGG + Intergenic
1078542211 11:12221738-12221760 CCTTTCAGCCAGCAGCTCCAGGG - Exonic
1078853526 11:15187049-15187071 CCTTCCAGCCATCCCCTCCATGG - Intronic
1079376071 11:19893208-19893230 CATTCTGGGCAGCACCCCCATGG - Intronic
1079404005 11:20129214-20129236 CCTTCTGGGCCTCACCTGCAAGG - Intergenic
1081969761 11:47189612-47189634 CATTCTAGGCAGGAGCTTCAGGG + Intergenic
1083431349 11:62615006-62615028 CCTTGTAGTCAGAACCACCAGGG + Exonic
1083610161 11:64000611-64000633 CCTTCCAGGCCGCGCCGCCAGGG + Intronic
1084112042 11:67020594-67020616 CCCTCTAGTCACCACCCCCATGG + Intronic
1084146888 11:67269767-67269789 CCACCTTGGCAGCCCCTCCATGG + Intronic
1084903363 11:72327134-72327156 CCTCTAAGGCAGCCCCTCCATGG + Intronic
1086167651 11:83798065-83798087 CCTTCTAAGCAGCATCTCCAAGG - Intronic
1086297698 11:85388808-85388830 ACATCAAGGCAGCACCGCCATGG + Intronic
1087021093 11:93604116-93604138 CCTCCTAGGCGGCTCCTCCCAGG - Intergenic
1087925030 11:103910291-103910313 CCATCTTGCCAGCAACTCCAGGG - Intronic
1092140445 12:6179974-6179996 TATTCTAGGCAGCTCCTTCATGG + Intergenic
1094828627 12:34289724-34289746 CCTTCAAAGCAGCCCCTGCATGG - Intergenic
1094830974 12:34300127-34300149 CCTTCCCAGCAGCACCTGCATGG + Intergenic
1094831309 12:34301558-34301580 CCTTCCCAGCAGCACCTACAGGG + Intergenic
1094833362 12:34310936-34310958 CCTTCTCAGCAGCTCCTGCACGG + Intergenic
1096609006 12:52788896-52788918 CCTTCTGGACAGCACTCCCATGG + Intergenic
1097309042 12:58098661-58098683 CAGTCTAGGCTGGACCTCCATGG + Intergenic
1100943163 12:99747196-99747218 CCTGCTAGGCATCACCACCTTGG + Intronic
1104631298 12:130405112-130405134 CCTTTTAGGCATGACCCCCAAGG + Intronic
1106076499 13:26465447-26465469 CTTTCTAGGCAGCATGCCCAGGG + Intergenic
1108350436 13:49585979-49586001 CCTCCCAGGCAGCACCACCTGGG - Intergenic
1108695901 13:52902044-52902066 CCTTCTTGGAATCACCTCCCTGG - Intergenic
1113836491 13:113331425-113331447 CCTTCTTGGCATCTCCTCCTGGG - Intronic
1114188198 14:20419658-20419680 CCTTCTAGCCATCTCCACCAGGG + Intergenic
1115552413 14:34516432-34516454 CCTTCTCGGCAGCATCTTCCCGG + Exonic
1119926755 14:78501929-78501951 TCTTCTATGCAGCCCCCCCAGGG + Intronic
1120827179 14:88966637-88966659 CCTTCTAGCAAGGACTTCCACGG - Intergenic
1121494558 14:94383135-94383157 TCTTCTGGGCAGCATCTCCCTGG + Exonic
1122039539 14:98974304-98974326 CCTCCAAGGCAACACCTCCCTGG - Intergenic
1124360297 15:29032023-29032045 TCTTCTAGACAGCCCTTCCAAGG - Intronic
1124632937 15:31347552-31347574 CCTCATGAGCAGCACCTCCAAGG - Intronic
1127310198 15:57745503-57745525 CCTTCTGGGCGGCTCCTTCATGG + Intronic
1128344724 15:66846318-66846340 CCTCCCAGTCAGCACCCCCAAGG - Intergenic
1129616670 15:77104355-77104377 CCTTCTCGTGAGCTCCTCCAGGG - Exonic
1129642529 15:77394522-77394544 CCACCAAGGCAGCACCTCTATGG + Intronic
1131279143 15:91006773-91006795 CCTTCTACACAGCATGTCCAAGG + Intronic
1133201836 16:4208521-4208543 CCTTCTTGGAAGCATCTCCAAGG - Intronic
1135468943 16:22712198-22712220 CCTTCAAGGAAGCCCTTCCAGGG - Intergenic
1136384108 16:29911959-29911981 GCTCCTGGCCAGCACCTCCAAGG - Exonic
1141981378 16:87552321-87552343 CCCTCCAGGCGGCACCTTCACGG + Intergenic
1145824297 17:27865531-27865553 CTTTCTAGGCAGCTATTCCAAGG + Intronic
1146063480 17:29618837-29618859 CCTGCTAGCCACCACCTGCAAGG - Exonic
1146526229 17:33569239-33569261 CCTTGCAGGCCCCACCTCCAGGG - Intronic
1146931618 17:36782207-36782229 CCTTCTAGGGACCACTTCCTAGG - Intergenic
1147267594 17:39244287-39244309 CCTCCTGGCCAGCTCCTCCAAGG + Intergenic
1148955138 17:51347444-51347466 GCTTGTAGGCAGCACTTTCAGGG + Intergenic
1151551185 17:74823392-74823414 CCTTCGGGCCAGCTCCTCCAAGG + Intronic
1151769708 17:76152244-76152266 CCTTCTTGGCAGGAACTGCAGGG + Intronic
1152889603 17:82873015-82873037 CCGTCTGGGCAGCAGCTCCCAGG + Intronic
1152949698 17:83221785-83221807 CCACCTAGTCAGCAGCTCCAGGG - Intergenic
1153568406 18:6444048-6444070 CCTCCTCAGCAACACCTCCAGGG - Intergenic
1153942519 18:9990346-9990368 CCTGCAGGGCAGCCCCTCCACGG - Intergenic
1154059086 18:11042104-11042126 CCTTCTAGTCATCTCCTCTAAGG + Intronic
1156846507 18:41671786-41671808 TCTTCTACACAGCATCTCCAAGG - Intergenic
1156898886 18:42277713-42277735 CTCCCTAGGCAGCAACTCCAAGG + Intergenic
1158335757 18:56414021-56414043 CCTTCAAAGCAGCCCCTCCCAGG + Intergenic
1160307635 18:77754889-77754911 CCTGCAAGACAGCACCTCCCGGG + Intergenic
1161352401 19:3801334-3801356 CCTTGCAGGCAGCATCTCCCTGG - Intronic
1165060427 19:33202524-33202546 CCTGCCAGCCGGCACCTCCAAGG - Intronic
1165258265 19:34592916-34592938 CCCTCAATGCAGAACCTCCAGGG - Intergenic
1167331700 19:48860200-48860222 TCTTCTAGGCCCCACCTCCAGGG - Intronic
1167770311 19:51510631-51510653 CCCTCTTGGCAGCACCTCCCAGG - Intergenic
926001067 2:9333025-9333047 CCTTTAATGCAGCAACTCCAAGG - Intronic
926042656 2:9686499-9686521 CCTTCTAGGCACCAGGTTCAAGG - Intergenic
927240848 2:20918525-20918547 CCCTCTCGGCAGCACATTCAGGG + Intergenic
934847687 2:97672707-97672729 CCCTCTGGGCAGCATTTCCAGGG + Intergenic
934849451 2:97688123-97688145 CCCTCTGGGCAGCATTTCCAGGG + Intergenic
935119289 2:100167546-100167568 TCTTCTAGGCAGCACATACTTGG - Intergenic
937250507 2:120520775-120520797 CCTTCCACCCACCACCTCCATGG - Intergenic
938073310 2:128319310-128319332 CCTACTGGGCTGCACTTCCAGGG + Intergenic
938405520 2:131030928-131030950 CCTTCAGGGCAGCACTCCCACGG + Intronic
940120021 2:150253938-150253960 CCTTATATGCAGCTCTTCCAGGG - Intergenic
941512793 2:166434609-166434631 TAATCTAGGCAGGACCTCCATGG + Intronic
942236361 2:173911559-173911581 CCTTCAAGGCAGTACCTCTTAGG - Intronic
943077178 2:183209591-183209613 CATTCTTGGCAGGACCCCCATGG + Intergenic
943934912 2:193903871-193903893 CCATCTTGGCTCCACCTCCAAGG - Intergenic
948145211 2:235703485-235703507 CCTCCTTGGCAGCATCTCCTTGG + Intronic
948830698 2:240597060-240597082 GGTTCTAGGCAGCGCCTCGAAGG - Intronic
948840592 2:240647007-240647029 CCTCCAAGGCAGCCCCTCCTGGG - Intergenic
1170194407 20:13675509-13675531 CCTTCTACACAGCTCCTCCATGG + Intergenic
1172020176 20:31908507-31908529 CCCCCTCGGCAGCACCTCCCTGG + Intronic
1172129524 20:32646539-32646561 CCTTCTAGACACCACCTGCTAGG - Intergenic
1175562257 20:59940225-59940247 CCTTCTTGTAAGAACCTCCAAGG - Exonic
1175823472 20:61924245-61924267 CCTCCTTGGCCACACCTCCAGGG - Intronic
1175989532 20:62780954-62780976 CTTTGCAGGCCGCACCTCCATGG - Intergenic
1178240420 21:30893530-30893552 CCTTATAGGCAGCATGCCCAGGG - Intergenic
1179640710 21:42745712-42745734 CCTGCCAGGCAGCACCACCCTGG - Intronic
1182130094 22:27844444-27844466 CCTCCTGGCCAGCACCTCCTGGG + Intergenic
1182370022 22:29804240-29804262 CCTTCTTGGAAGCCCCTCCGTGG - Intronic
1183075934 22:35426708-35426730 CCTTCCTGGGAGCACCTCCCCGG - Intergenic
1185166172 22:49263626-49263648 TCTTCCAGGCAGGACCCCCAGGG + Intergenic
953849013 3:46450915-46450937 CCTGCCAGGCAGCAGCTGCACGG - Intronic
954840994 3:53511435-53511457 CTTTCTAGGAAGCACATCCAAGG + Intronic
955341801 3:58130733-58130755 TCTTCCAGGCAGCCCCTTCAGGG + Exonic
955352329 3:58203068-58203090 CCTTCTGAGCAGCTCCTCCTGGG + Intronic
956818231 3:72928539-72928561 GCTTCTAGGCCACACCTCCATGG - Intronic
957920579 3:86743078-86743100 GCTTTTAGGCAGCACTTCTAGGG + Intergenic
960963491 3:123089080-123089102 AGCTCTAGGCAGCACATCCATGG + Intronic
961368948 3:126418096-126418118 CCTTCTAGCCAGGACCTGAATGG - Intronic
961394396 3:126577214-126577236 GGTTCTTGGCAGCCCCTCCAAGG + Intronic
963549650 3:146703169-146703191 CCTCCTAGTCAGCCCCTCCCAGG - Intergenic
968036820 3:195554594-195554616 CCTTCATGGCAGCGGCTCCACGG - Intergenic
968757756 4:2425778-2425800 CCCCCTAGGCAGCTTCTCCAAGG + Intronic
969128071 4:4968864-4968886 CTCTCTAGGCTGCACCTCTAGGG + Intergenic
969463699 4:7342556-7342578 CCTTTCACGCCGCACCTCCAAGG - Intronic
971501261 4:27320263-27320285 CCTTCAAGGCAGTACCTGCATGG - Intergenic
972437859 4:39051640-39051662 CCATCTGGGCAGCACCTCAGAGG + Intronic
972928491 4:44041092-44041114 CCCTCTGGGCACCACCACCATGG - Intergenic
979276013 4:118815081-118815103 CCATCTGTGCAGGACCTCCAGGG + Exonic
979420719 4:120502277-120502299 CCTACTAGGCAGTACCCCAATGG + Intergenic
982678130 4:158399582-158399604 ATTTCTAGGCAGGATCTCCAAGG + Intronic
983395906 4:167195386-167195408 CCTTCTTGGGAACACATCCATGG - Intronic
985171830 4:187158221-187158243 CCTTCTCTGCAGCTCCTCAACGG + Intergenic
985566453 5:620787-620809 TCTTGTAGGCAGAACTTCCAGGG + Intronic
985884647 5:2668198-2668220 CCTTCGAGGCTTCACCTGCATGG + Intergenic
987616230 5:20277399-20277421 CCACCCAGGCAGCACCTCTATGG + Intronic
990041864 5:51386582-51386604 CCATCTAGGCTGCACTTCCCTGG - Intronic
990608179 5:57430925-57430947 TCTGCCAGGCAGGACCTCCATGG + Intergenic
991041772 5:62183414-62183436 TCCTATAGGCACCACCTCCATGG + Intergenic
992508403 5:77409958-77409980 GCTTCTAGGCAGCACTGCCAAGG + Intronic
994870780 5:105347741-105347763 CATTATAGGCAGCAATTCCAAGG - Intergenic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
997197239 5:131988302-131988324 CATGCCAGGCAGCACTTCCATGG + Intronic
997388084 5:133489490-133489512 CCTTCTAGATAGTACCTCAAAGG - Intronic
999237229 5:150106177-150106199 CCTTCCCGGCAGCATCACCAAGG - Intronic
1001978589 5:176021471-176021493 CCTCCCAGGCACCACCTCCCTGG - Intronic
1002238828 5:177822291-177822313 CCTCCCAGGCACCACCTCCCTGG + Intergenic
1002629561 5:180562016-180562038 CCTTTTAGGCAGCCCTTCCCTGG + Intronic
1002693275 5:181065790-181065812 CCTTCTGGGCAGCCTCTCCCGGG - Intergenic
1002743930 5:181455597-181455619 CCACCTAGTCAGCAGCTCCAGGG - Intergenic
1004594619 6:17087218-17087240 CCTGATAGGCAGCATTTCCATGG + Intergenic
1004748727 6:18539040-18539062 CCATCTAGGCAGCTCTCCCATGG - Intergenic
1005234784 6:23747403-23747425 CCCTCTACACATCACCTCCAAGG + Intergenic
1005612031 6:27535526-27535548 ACTGCTAGGCAGCTCCTACAGGG + Intergenic
1006507278 6:34497541-34497563 CCTTCTTGGAATCCCCTCCAAGG + Intronic
1006633157 6:35443534-35443556 CTTGCTAGCCAGCCCCTCCAGGG - Intergenic
1008306955 6:49914924-49914946 CCATCTAGGCAGCATTTCTAGGG + Intergenic
1010328030 6:74587803-74587825 CATTCCAGGCCGCAGCTCCAAGG + Intergenic
1010927663 6:81763447-81763469 CCTTCTAGGCATCAGGCCCATGG + Intergenic
1019181997 6:170193355-170193377 GCTTCTGGGCGGCCCCTCCAGGG - Intergenic
1019248789 6:170728826-170728848 CCACCTAGTCAGCAGCTCCAGGG - Intergenic
1020125805 7:5531885-5531907 GCTTCTTGTCACCACCTCCAAGG - Intronic
1022786230 7:33640256-33640278 CCTTCCAGTCACCACCCCCAGGG + Intergenic
1023037060 7:36141098-36141120 CCTTGTAGGCAGCACATACTTGG - Intergenic
1024678792 7:51661882-51661904 CCTCCTTGGCAGCACCTCCGTGG - Intergenic
1024892055 7:54214482-54214504 TCTTCTAGGCAGCAGATCAATGG - Intergenic
1026396395 7:69958732-69958754 ACTGCTAGGCTCCACCTCCAAGG + Intronic
1029023288 7:97387941-97387963 CCTTCTTGGCCTCAGCTCCATGG + Intergenic
1032161436 7:129513877-129513899 CACTGTAGGCAGCACCTCCGGGG + Intergenic
1032482095 7:132255430-132255452 CCTTATAGGCACGACCACCATGG + Intronic
1032997972 7:137469549-137469571 CCATCTAGGAAGCACCACCGAGG + Exonic
1034966508 7:155394767-155394789 CCTGAGAGGCAGCTCCTCCATGG - Intronic
1035499256 8:78509-78531 CCACCTAGTCAGCAGCTCCAGGG + Intronic
1035777760 8:2202826-2202848 CCATTCAGGCAGCACCTCCCAGG + Intergenic
1040275615 8:46012231-46012253 CCTTCCTGGCAGCCCCTGCATGG - Intergenic
1047770243 8:128025010-128025032 ATTTCTAGACAACACCTCCAAGG + Intergenic
1048292757 8:133192958-133192980 TCTTCTAGGCAGCCCCTGCCTGG + Intronic
1048377514 8:133835498-133835520 CCTCACAGGCAGCATCTCCAGGG - Intergenic
1049795624 8:144496146-144496168 CCTGCTAGGCTGCTCCTCCAGGG - Intronic
1050214666 9:3309314-3309336 CCTTCTAGGAAGAACCTGTAGGG + Intronic
1056706316 9:88955236-88955258 GATTCTAGGAAGCACTTCCAGGG + Intergenic
1057075959 9:92138254-92138276 GCCTCTAGGCAGCACCACCCGGG + Intergenic
1061161759 9:128899420-128899442 CCAGACAGGCAGCACCTCCAGGG - Intronic
1061234421 9:129334332-129334354 CCTTCCAGGCAGAGCCTTCAGGG - Intergenic
1061391399 9:130319182-130319204 CCTCCCAGGAAGCCCCTCCAAGG - Intronic
1061485250 9:130917345-130917367 CCCTCTAAGCGGCACTTCCAAGG - Intronic
1061724725 9:132575840-132575862 CCTTCTTGGCAACACCTCATAGG + Intergenic
1062000036 9:134211343-134211365 CCAACTAGGCCGCAGCTCCACGG + Intergenic
1062149185 9:135008734-135008756 TGCTCTTGGCAGCACCTCCAGGG - Intergenic
1062615380 9:137393755-137393777 CCTGCCTGGCAGCCCCTCCATGG - Intronic
1203609745 Un_KI270748v1:86090-86112 CCACCTAGTCAGCAGCTCCAGGG - Intergenic
1185907822 X:3953040-3953062 CATTCATGGCAGCAGCTCCACGG - Intergenic
1187219769 X:17312660-17312682 CATTCTGGGCAGCACCCTCAAGG - Intergenic
1194348609 X:92796651-92796673 TCTTATAGGCAGCAGCTCAATGG - Intergenic
1195349930 X:103986180-103986202 CCCTCCAGCCAGCCCCTCCAAGG - Intergenic
1195357513 X:104052659-104052681 CCCTCCAGCCAGCCCCTCCAAGG + Intergenic
1196168508 X:112561714-112561736 ACTGCTAGGCAGAACCACCAAGG - Intergenic
1197900520 X:131366974-131366996 CCTTCTGGTCAGAACCTCCCTGG - Intronic
1200235015 X:154463943-154463965 CCTTCGCGGCAGCACCTGCACGG - Exonic
1200656936 Y:5913279-5913301 TCTTATAGGCAGCAGCTCAATGG - Intergenic